ID: 1164903950

View in Genome Browser
Species Human (GRCh38)
Location 19:31951678-31951700
Sequence TTAGGGTGTGAACATTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164903950_1164903959 17 Left 1164903950 19:31951678-31951700 CCATCAAAATGTTCACACCCTAA No data
Right 1164903959 19:31951718-31951740 TGTTAACTCACATGACAAAAGGG No data
1164903950_1164903960 27 Left 1164903950 19:31951678-31951700 CCATCAAAATGTTCACACCCTAA No data
Right 1164903960 19:31951728-31951750 CATGACAAAAGGGACTTTGCAGG No data
1164903950_1164903953 -10 Left 1164903950 19:31951678-31951700 CCATCAAAATGTTCACACCCTAA No data
Right 1164903953 19:31951691-31951713 CACACCCTAAGCCTGGTCCTGGG No data
1164903950_1164903958 16 Left 1164903950 19:31951678-31951700 CCATCAAAATGTTCACACCCTAA No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164903950 Original CRISPR TTAGGGTGTGAACATTTTGA TGG (reversed) Intergenic
No off target data available for this crispr