ID: 1164903956

View in Genome Browser
Species Human (GRCh38)
Location 19:31951702-31951724
Sequence GTTAACAGAATCCCAGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164903956_1164903959 -7 Left 1164903956 19:31951702-31951724 CCTGGTCCTGGGATTCTGTTAAC No data
Right 1164903959 19:31951718-31951740 TGTTAACTCACATGACAAAAGGG No data
1164903956_1164903958 -8 Left 1164903956 19:31951702-31951724 CCTGGTCCTGGGATTCTGTTAAC No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data
1164903956_1164903960 3 Left 1164903956 19:31951702-31951724 CCTGGTCCTGGGATTCTGTTAAC No data
Right 1164903960 19:31951728-31951750 CATGACAAAAGGGACTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164903956 Original CRISPR GTTAACAGAATCCCAGGACC AGG (reversed) Intergenic
No off target data available for this crispr