ID: 1164903958

View in Genome Browser
Species Human (GRCh38)
Location 19:31951717-31951739
Sequence CTGTTAACTCACATGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164903954_1164903958 -1 Left 1164903954 19:31951695-31951717 CCCTAAGCCTGGTCCTGGGATTC No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data
1164903950_1164903958 16 Left 1164903950 19:31951678-31951700 CCATCAAAATGTTCACACCCTAA No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data
1164903949_1164903958 17 Left 1164903949 19:31951677-31951699 CCCATCAAAATGTTCACACCCTA No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data
1164903948_1164903958 18 Left 1164903948 19:31951676-31951698 CCCCATCAAAATGTTCACACCCT No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data
1164903955_1164903958 -2 Left 1164903955 19:31951696-31951718 CCTAAGCCTGGTCCTGGGATTCT No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data
1164903956_1164903958 -8 Left 1164903956 19:31951702-31951724 CCTGGTCCTGGGATTCTGTTAAC No data
Right 1164903958 19:31951717-31951739 CTGTTAACTCACATGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164903958 Original CRISPR CTGTTAACTCACATGACAAA AGG Intergenic
No off target data available for this crispr