ID: 1164905734

View in Genome Browser
Species Human (GRCh38)
Location 19:31966494-31966516
Sequence CTCCTGTGACTGCAATTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164905734_1164905737 30 Left 1164905734 19:31966494-31966516 CCTCTCAATTGCAGTCACAGGAG No data
Right 1164905737 19:31966547-31966569 GAGCAACATCTGTAGCTCAGAGG No data
1164905734_1164905736 8 Left 1164905734 19:31966494-31966516 CCTCTCAATTGCAGTCACAGGAG No data
Right 1164905736 19:31966525-31966547 TTTACTTGTTCTAAGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164905734 Original CRISPR CTCCTGTGACTGCAATTGAG AGG (reversed) Intergenic
No off target data available for this crispr