ID: 1164905755

View in Genome Browser
Species Human (GRCh38)
Location 19:31966645-31966667
Sequence GAGTGGGGCCATGTACCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164905755_1164905762 21 Left 1164905755 19:31966645-31966667 CCGGCAGGTACATGGCCCCACTC No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905755_1164905764 26 Left 1164905755 19:31966645-31966667 CCGGCAGGTACATGGCCCCACTC No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905755_1164905763 22 Left 1164905755 19:31966645-31966667 CCGGCAGGTACATGGCCCCACTC No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164905755 Original CRISPR GAGTGGGGCCATGTACCTGC CGG (reversed) Intergenic
No off target data available for this crispr