ID: 1164905762

View in Genome Browser
Species Human (GRCh38)
Location 19:31966689-31966711
Sequence GTATAAATGAATTACCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 141}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164905755_1164905762 21 Left 1164905755 19:31966645-31966667 CCGGCAGGTACATGGCCCCACTC No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905760_1164905762 -6 Left 1164905760 19:31966672-31966694 CCCACTTAGCAAATTATGTATAA No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905757_1164905762 5 Left 1164905757 19:31966661-31966683 CCCACTCTCGCCCCACTTAGCAA No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905761_1164905762 -7 Left 1164905761 19:31966673-31966695 CCACTTAGCAAATTATGTATAAA No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905758_1164905762 4 Left 1164905758 19:31966662-31966684 CCACTCTCGCCCCACTTAGCAAA No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905759_1164905762 -5 Left 1164905759 19:31966671-31966693 CCCCACTTAGCAAATTATGTATA No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905754_1164905762 22 Left 1164905754 19:31966644-31966666 CCCGGCAGGTACATGGCCCCACT No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141
1164905756_1164905762 6 Left 1164905756 19:31966660-31966682 CCCCACTCTCGCCCCACTTAGCA No data
Right 1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG 0: 1
1: 0
2: 1
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164905762 Original CRISPR GTATAAATGAATTACCTTCC TGG Intergenic
906174187 1:43755556-43755578 GGATGAATGTATTTCCTTCCTGG + Intronic
906937918 1:50230484-50230506 CAATAAATGAATGCCCTTCCAGG + Intergenic
907113998 1:51952623-51952645 GTATTTATGGAGTACCTTCCAGG - Intronic
908933394 1:69343649-69343671 GTATATAAAAATTACCTTGCAGG + Intergenic
910832713 1:91476676-91476698 TTGTAAAAGAATTTCCTTCCTGG + Intergenic
911765522 1:101669969-101669991 ATAGGAATGAATTAACTTCCTGG - Intergenic
912131192 1:106602929-106602951 GTATAAATATATTACATTCAAGG - Intergenic
915830473 1:159124856-159124878 GTCTGAATAATTTACCTTCCAGG + Intronic
916337426 1:163689106-163689128 TTTTAAATGAATTGCTTTCCTGG + Intergenic
916626461 1:166563187-166563209 GTATTAATGGAGTTCCTTCCAGG + Intergenic
917940278 1:179912905-179912927 GTATATATAAATGAACTTCCTGG - Intronic
918094385 1:181322497-181322519 GTGCAAATAAAGTACCTTCCTGG + Intergenic
918412719 1:184276979-184277001 GAATAGATGAATGACCTACCTGG + Intergenic
922647685 1:227306288-227306310 GTACAAATGGGTTACGTTCCTGG - Intronic
923884943 1:238144327-238144349 GTAGAAATGATTTGCCTTCCTGG + Intergenic
924116781 1:240754745-240754767 GAAGAAATGAATTAACTTGCAGG - Intergenic
1063702139 10:8394886-8394908 GTATAAAAGATTTACCACCCAGG + Intergenic
1064129160 10:12692788-12692810 GAATCAATGAATTTCTTTCCTGG - Intronic
1069591641 10:69645639-69645661 GTATAAATAAAATGCTTTCCAGG - Intergenic
1074856394 10:117477134-117477156 TTATCAATGGATTACTTTCCTGG + Intergenic
1077747944 11:4928580-4928602 GTATAAATTAATTCCAATCCTGG - Intronic
1078288189 11:9979640-9979662 GTATAAATAAATTATTTTTCTGG - Intronic
1078985150 11:16586759-16586781 ATAGAAATGAATTACCTAACTGG + Intronic
1079044788 11:17091788-17091810 GTATAAATCAATGACCTATCAGG - Intronic
1082064112 11:47885010-47885032 CTATGAATTAATTAACTTCCAGG + Intergenic
1083246494 11:61431988-61432010 GTATAAATGGATTAAACTCCAGG - Intronic
1084123610 11:67084138-67084160 GTAAAAATGAATCTCCTGCCAGG + Intergenic
1085858522 11:80204633-80204655 GTTTAAATGACTTACCTTGTTGG - Intergenic
1087896950 11:103596680-103596702 GAATGTATGAATTACCATCCTGG - Intergenic
1087953507 11:104254898-104254920 ATATAAGTGAATTACCTACTGGG - Intergenic
1088935424 11:114395038-114395060 GAATGAATGAATAACCTTCACGG - Intronic
1089924277 11:122241146-122241168 GTATGAAAGAATTACCATCTTGG + Intergenic
1090159149 11:124473133-124473155 ATATAAATGAAATAACTTGCTGG + Intergenic
1091112586 11:132983698-132983720 GTATAAATAAATAACTTTCCTGG - Intronic
1091510369 12:1117897-1117919 CTATAAATGAATAACTTTGCAGG - Intronic
1092773784 12:11923192-11923214 TTAAAAATGTATTTCCTTCCAGG + Intergenic
1095967851 12:47881396-47881418 GTATGAATGAATTGTCTCCCAGG - Intronic
1098155974 12:67598891-67598913 GAATGAATGAATTTCTTTCCTGG + Intergenic
1099543202 12:83941253-83941275 GCATAAATGAATTATTTTCCTGG + Intergenic
1100067148 12:90663079-90663101 ATCTTAATGAATTAACTTCCTGG - Intergenic
1101259977 12:103019154-103019176 GTATAGATTAATGCCCTTCCTGG - Intergenic
1101937401 12:109069517-109069539 ATATAAATGAATTCCCTCCTGGG - Intronic
1103416675 12:120746566-120746588 ACATAAATGATTTATCTTCCAGG + Intergenic
1106767440 13:32927885-32927907 GCAAAAATCAATTACCTTTCTGG - Intergenic
1107125974 13:36847243-36847265 GTATAAATGAAGAAACTTCTTGG + Exonic
1109257152 13:60097308-60097330 GAATAGATTAATGACCTTCCTGG + Intronic
1110850514 13:80239639-80239661 GAATTAATGTATTACTTTCCAGG - Intergenic
1111068484 13:83130440-83130462 GCTTAAATGAATTACATTTCTGG + Intergenic
1111140784 13:84115323-84115345 GAATAGATGAATTCCCTTTCTGG + Intergenic
1112034203 13:95482678-95482700 GTATAAATGAATAAACTGGCTGG + Intronic
1112548834 13:100400412-100400434 GTATAAATGAGTTATTTTCTAGG + Intronic
1112841625 13:103586236-103586258 ATATAAATGAATGACCTTATGGG + Intergenic
1117734280 14:58753131-58753153 GTTTAACAGAATAACCTTCCTGG + Intergenic
1118599354 14:67460824-67460846 ATATAAATGTTTTACCTTTCTGG + Intronic
1118842736 14:69525269-69525291 GTACGCATGAATTACCTTCAAGG + Intronic
1119624565 14:76161406-76161428 GTATTAATAAATTACCATCTGGG - Intronic
1120110036 14:80543105-80543127 GTAAAAATAAAATACCTTGCCGG - Intronic
1121049907 14:90813524-90813546 ATTTAAATGACTTACCTTGCAGG - Intronic
1121883299 14:97519461-97519483 ACATAAATGTATTACCATCCAGG - Intergenic
1126338467 15:47613361-47613383 GTATGCATCAATTTCCTTCCAGG + Intronic
1130160564 15:81395013-81395035 GTAAGGATGCATTACCTTCCTGG - Intergenic
1134057419 16:11179365-11179387 GGAATAATGAAGTACCTTCCTGG + Exonic
1135197263 16:20404677-20404699 GCAGAAATGAAGTCCCTTCCTGG + Exonic
1136229018 16:28876270-28876292 GTAGAAATGAATAACCTTAAAGG + Intergenic
1139228590 16:65257957-65257979 GAATAAATAAATTCCCTTTCTGG + Intergenic
1141263325 16:82473546-82473568 GCCTAAATGTATTACCTTACAGG + Intergenic
1146576576 17:33998132-33998154 GGAAAAATGAATAACCTTCTAGG - Intronic
1149432217 17:56603477-56603499 ATATTAATTAATTACCTTCCTGG + Intergenic
1155307261 18:24490509-24490531 GTATAATGTAATTATCTTCCTGG + Intergenic
1156184816 18:34649997-34650019 GAATAAGTGAAATACCTGCCAGG - Intronic
1159147982 18:64479607-64479629 GTATAAATGAATCAACTCACTGG + Intergenic
1159579235 18:70216583-70216605 GAATAAATGAACGAACTTCCAGG + Intergenic
1159898887 18:74023451-74023473 GAATAAATTAATGACCTCCCTGG + Intergenic
1164905762 19:31966689-31966711 GTATAAATGAATTACCTTCCTGG + Intergenic
925449444 2:3956112-3956134 GTACTAATGAATTTCCTTCCCGG + Intergenic
930063976 2:47313579-47313601 GAATGAATGAATGAACTTCCTGG + Intergenic
932513979 2:72325930-72325952 CTATAAAAGAATTAACTACCTGG - Intronic
934159920 2:89239064-89239086 GAAAAAATTAATAACCTTCCAGG - Intergenic
934207359 2:89943370-89943392 GAAAAAATTAATAACCTTCCAGG + Intergenic
936242002 2:110795899-110795921 GCATAAATGACTTAGCTACCTGG + Intronic
936518074 2:113195074-113195096 GGAGAAATGAATTACCTACATGG - Intronic
937066154 2:119019583-119019605 GTATAATAGTATTACCTCCCAGG - Intergenic
938111318 2:128567952-128567974 GAAGAAATGAATTACTTTTCAGG - Intergenic
940255793 2:151727511-151727533 GTATAAATGAATTACATAAAAGG + Intronic
943593443 2:189827034-189827056 GTATCAGTGACTTAGCTTCCAGG - Intronic
944952111 2:204763418-204763440 GCCTAAATAAATTAGCTTCCTGG + Intronic
946482603 2:220071698-220071720 GCAAAAAAGAATTACTTTCCGGG - Intergenic
947138640 2:227000555-227000577 GTATGAAGGAATTGCCTTGCTGG + Intergenic
947165742 2:227260064-227260086 AGATAATTTAATTACCTTCCTGG - Intronic
947823646 2:233089703-233089725 GAATAAATGAATGAGCTGCCGGG - Intronic
947954923 2:234180723-234180745 CTAAAAATGAATTACCTTGCTGG - Intergenic
1170576541 20:17666478-17666500 GCAGAAATGAATTACTTTGCTGG - Intronic
1170905196 20:20508945-20508967 GTACAATTGAATTAGCTCCCTGG - Intronic
1177613650 21:23488657-23488679 GTAAAACTGAATTATCTCCCAGG - Intergenic
1178865436 21:36322999-36323021 ATATAAATCAATTAACTTCAGGG - Intronic
1182963194 22:34495968-34495990 GTATAAATACATTATATTCCAGG + Intergenic
953569582 3:44060541-44060563 GAATAAAGCAATTAACTTCCTGG - Intergenic
955602771 3:60665750-60665772 GTTTAGATGATTTACCTTCAAGG + Intronic
956218792 3:66879882-66879904 GCATATAAGAATTACCTGCCTGG + Intergenic
956493641 3:69801104-69801126 GTACAAATGAACAACCTTCACGG - Intronic
959907929 3:111731149-111731171 GTGCAAATGTATTACCTTGCAGG + Intronic
964349264 3:155786839-155786861 AAATAAATAAATAACCTTCCAGG + Intronic
965670791 3:171145609-171145631 GGATAAATGCATTACCTTTGAGG - Intronic
967110502 3:186289105-186289127 GTATAGATGAATTTCCTGCAAGG - Intronic
974241351 4:59252516-59252538 GTATAAATAAATTAACTGACAGG - Intergenic
975609740 4:76192065-76192087 CTATAAAGAAATAACCTTCCTGG - Intronic
977799915 4:101215109-101215131 GTAGAAATGAATTTCCCTCAAGG - Intronic
978389962 4:108215180-108215202 GAATAAATGAATGGCTTTCCTGG - Intergenic
980015036 4:127639944-127639966 GTAGAAATAAAGAACCTTCCAGG + Intronic
980477853 4:133342810-133342832 GTACACATGAAATAACTTCCAGG - Intergenic
983080325 4:163377525-163377547 ATATAAATGAAATACTTTTCTGG + Intergenic
984835431 4:184015446-184015468 CTATAAATGGATTACCTTTCTGG + Intronic
990346278 5:54874937-54874959 GAATAAAATAATCACCTTCCTGG - Intergenic
991442548 5:66666105-66666127 AACTAAATGAATAACCTTCCTGG - Intronic
991678915 5:69118329-69118351 ATATATATGAAGGACCTTCCAGG + Intronic
992471343 5:77058257-77058279 ATATTAATTAATTGCCTTCCTGG - Intronic
992909938 5:81386397-81386419 GTATACATTAATTACCTTGAAGG + Intronic
995617794 5:113986203-113986225 GTATAATTGAACTAATTTCCTGG + Intergenic
999058480 5:148607885-148607907 GTATAAATAAATAACTTTCATGG - Intronic
999762260 5:154711672-154711694 GAATTCTTGAATTACCTTCCAGG + Intergenic
1004269735 6:14184154-14184176 GTGGAAATGATTTACCCTCCTGG + Intergenic
1010176468 6:73033397-73033419 GGTTAAATGAATTACTTTTCAGG + Intronic
1011778774 6:90762789-90762811 GTATCAATGAATTGCCTATCTGG + Intergenic
1012582251 6:100883078-100883100 GGCTAACTGAATTTCCTTCCAGG - Intergenic
1015945574 6:138496785-138496807 ATAGAAATGAATTTCCTACCAGG + Intronic
1015991710 6:138951453-138951475 GTCTAAATGAAATTCATTCCAGG - Intronic
1017571124 6:155745528-155745550 GTAAAAATGAACTACCTTCCTGG + Intergenic
1020883703 7:13796108-13796130 GTAAAGATGAATTACCATGCAGG + Intergenic
1023563594 7:41501128-41501150 GTATAAATTAATGGCCTTCTTGG - Intergenic
1027680575 7:81215366-81215388 ATATAAAGGCATTACCTTCTGGG - Intergenic
1027713497 7:81639501-81639523 TTAGAAATGAAGTCCCTTCCAGG + Intergenic
1027890923 7:83973758-83973780 GCATGCATGCATTACCTTCCTGG - Intronic
1028147833 7:87337941-87337963 GTTTAAATGAATGAGCTTCAGGG + Intergenic
1028927847 7:96379630-96379652 TTCCAATTGAATTACCTTCCAGG + Intergenic
1032874382 7:136022004-136022026 GTATAAATGAATTAACTTTATGG - Intergenic
1032977311 7:137240450-137240472 GGATAAATTAATGACCTTACTGG - Intronic
1035145328 7:156810305-156810327 GAATAGATGAATTCCCTCCCGGG - Intronic
1043259773 8:78181951-78181973 TTCTAAATAAATAACCTTCCAGG + Intergenic
1044795932 8:95897654-95897676 GTATAAATGATTTAACTTATAGG + Intergenic
1044833348 8:96271631-96271653 GTATAAATAAATCACCTTTATGG - Intronic
1046507277 8:115152212-115152234 TTATAAATGAATTACTTAACTGG + Intergenic
1047612106 8:126531203-126531225 ATAGAAGTGTATTACCTTCCTGG + Intergenic
1047972584 8:130097908-130097930 GTATAAGTGAATGAATTTCCAGG - Intronic
1048795450 8:138145364-138145386 GCACACAGGAATTACCTTCCTGG + Intronic
1049370951 8:142266677-142266699 ACATACATGAAATACCTTCCTGG - Intronic
1051298569 9:15623245-15623267 GCAAAAATGAATTATTTTCCAGG + Exonic
1051407933 9:16759038-16759060 CTTTAAATGAATTAGTTTCCTGG - Intronic
1186582357 X:10833818-10833840 GTAAACATGAATTGCATTCCTGG + Intergenic
1188575102 X:31639384-31639406 GTAAAATTGAGTTACGTTCCAGG - Intronic
1189242145 X:39533575-39533597 GGATGAATGAATTAGCTTCTGGG - Intergenic
1199621108 X:149702109-149702131 GTATACATGGATCACCTTTCAGG - Intronic