ID: 1164905763

View in Genome Browser
Species Human (GRCh38)
Location 19:31966690-31966712
Sequence TATAAATGAATTACCTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 285}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164905761_1164905763 -6 Left 1164905761 19:31966673-31966695 CCACTTAGCAAATTATGTATAAA No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285
1164905760_1164905763 -5 Left 1164905760 19:31966672-31966694 CCCACTTAGCAAATTATGTATAA No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285
1164905756_1164905763 7 Left 1164905756 19:31966660-31966682 CCCCACTCTCGCCCCACTTAGCA No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285
1164905758_1164905763 5 Left 1164905758 19:31966662-31966684 CCACTCTCGCCCCACTTAGCAAA No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285
1164905759_1164905763 -4 Left 1164905759 19:31966671-31966693 CCCCACTTAGCAAATTATGTATA No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285
1164905757_1164905763 6 Left 1164905757 19:31966661-31966683 CCCACTCTCGCCCCACTTAGCAA No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285
1164905754_1164905763 23 Left 1164905754 19:31966644-31966666 CCCGGCAGGTACATGGCCCCACT No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285
1164905755_1164905763 22 Left 1164905755 19:31966645-31966667 CCGGCAGGTACATGGCCCCACTC No data
Right 1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164905763 Original CRISPR TATAAATGAATTACCTTCCT GGG Intergenic
902732701 1:18379998-18380020 TGTAAATACATTACCTTCCATGG + Intergenic
903237472 1:21959498-21959520 TGTAAGTAAATCACCTTCCTAGG + Intergenic
904074766 1:27831520-27831542 TAAATATGAATTACCTTACAAGG + Intronic
904830175 1:33301190-33301212 TATTACTAAATTTCCTTCCTAGG - Intergenic
905068985 1:35208804-35208826 TATTATTGAATAACCTACCTTGG + Intergenic
906174188 1:43755557-43755579 GATGAATGTATTTCCTTCCTGGG + Intronic
907013011 1:50981731-50981753 TATAAACAAATTAACTTTCTTGG + Intergenic
907576503 1:55530905-55530927 TGTAAATGTATTACCCACCTGGG - Intergenic
908632900 1:66129932-66129954 AATAATTTAATTACCTTGCTAGG + Intronic
909732407 1:78910470-78910492 TTTAAATAAAATACCTTACTTGG + Intronic
912879840 1:113399863-113399885 TCTAAACGAATTACTTTCCAAGG + Intronic
913313442 1:117528365-117528387 TATAAATGAACTGCCTTTCCAGG + Exonic
916005589 1:160656647-160656669 TACAAATGAATGTCATTCCTGGG + Intergenic
916814580 1:168338892-168338914 TATAATTCAATTACCTCCCCTGG + Intergenic
918412720 1:184276980-184277002 AATAGATGAATGACCTACCTGGG + Intergenic
918903538 1:190458564-190458586 TATTACTGAATTACCTTAATTGG + Intronic
919491289 1:198208584-198208606 AATAAATGCATTACCAACCTGGG - Intronic
919524400 1:198629433-198629455 AGAAAATCAATTACCTTCCTAGG + Intergenic
919856874 1:201712161-201712183 TATATCTGAACTAACTTCCTGGG + Intronic
919936778 1:202256557-202256579 TATAGCTGAATTATATTCCTTGG + Intronic
923495973 1:234525103-234525125 TGTAAATAAATTATCTTACTGGG - Intergenic
924258464 1:242205688-242205710 TACCAATGAAATACTTTCCTAGG + Intronic
924326629 1:242901304-242901326 TATCAGAGAATGACCTTCCTAGG - Intergenic
1064129159 10:12692787-12692809 AATCAATGAATTTCTTTCCTGGG - Intronic
1066028841 10:31396186-31396208 AATAAATGAATTAACTTCAATGG - Intronic
1067356467 10:45532883-45532905 TATAAATGACTTATCTTCATTGG - Intronic
1068418714 10:56761466-56761488 TATAAACTAATTATCTCCCTTGG + Intergenic
1068755183 10:60644819-60644841 TTTAACTAAATTAACTTCCTTGG - Intronic
1068997228 10:63221430-63221452 TTTAAATTAATTATGTTCCTTGG + Intronic
1070272993 10:74976056-74976078 TAAAACTGAATTATCTTCCACGG + Exonic
1071927624 10:90428762-90428784 TATAAATATATTACCTTACATGG - Intergenic
1072743588 10:97924756-97924778 TATAGATGAACTACTTTCCAAGG + Intronic
1073348772 10:102804044-102804066 TAAAAATGAACTTTCTTCCTTGG + Intronic
1073707676 10:106004060-106004082 TGTAAATTACTTACCTTTCTAGG - Intergenic
1075192785 10:120326387-120326409 TAAATATGCTTTACCTTCCTCGG + Intergenic
1075569329 10:123528090-123528112 TATTAATGAATTACTTGGCTGGG - Intergenic
1077698321 11:4415667-4415689 GATAAATCAATTTCATTCCTAGG + Intergenic
1078670295 11:13358485-13358507 TATAGATGAATTGGCTTCTTTGG + Exonic
1079890564 11:26047838-26047860 CACAATTGAATTTCCTTCCTGGG - Intergenic
1079930949 11:26559568-26559590 TATATATGAATTCCTTTCATGGG - Exonic
1083688946 11:64394964-64394986 AAGAAATGAATTTTCTTCCTAGG - Intergenic
1085337863 11:75710831-75710853 AATGAATGAATTAAATTCCTAGG - Intergenic
1085947889 11:81294280-81294302 TGAAAATGAAATAGCTTCCTTGG + Intergenic
1086493788 11:87382206-87382228 TATCAATGTATTAGCTTCCTTGG + Intergenic
1087283751 11:96242083-96242105 AAAAAGTGAATTAACTTCCTTGG - Intronic
1087788278 11:102380194-102380216 TATAAAAGAGTTACCTTATTTGG + Intergenic
1087876676 11:103367088-103367110 TCTAAATGAATTACTTCTCTGGG + Intronic
1087953506 11:104254897-104254919 TATAAGTGAATTACCTACTGGGG - Intergenic
1089754528 11:120676808-120676830 TGCAAATGCATTACCTTCCATGG - Intronic
1090099741 11:123781750-123781772 TATAAATGAATTAGGTTTTTAGG - Intergenic
1090159150 11:124473134-124473156 TATAAATGAAATAACTTGCTGGG + Intergenic
1093725858 12:22507583-22507605 TTTCAATGAATTTCCTTTCTTGG - Intronic
1094147010 12:27239650-27239672 TATATTTGATTTACATTCCTTGG + Intergenic
1095364305 12:41384164-41384186 AATAAATGAATTAGCAGCCTAGG - Intronic
1095417355 12:41991133-41991155 AGTAAATGAATCACCTGCCTGGG + Intergenic
1096349725 12:50886521-50886543 TCTAAGTGAATTGCATTCCTAGG + Intronic
1097569385 12:61313776-61313798 TGTATATGAATGACCTTTCTCGG - Intergenic
1098157497 12:67614756-67614778 TGGAAATCACTTACCTTCCTAGG - Intergenic
1099039808 12:77637840-77637862 TACAAAGTAATTACCTTCTTTGG - Intergenic
1100172269 12:91988596-91988618 TATAAATGAATTCCCTTTTGAGG - Intronic
1100824878 12:98465239-98465261 AATAAATGCATTAGATTCCTAGG + Intergenic
1101035759 12:100704249-100704271 TAAACATGAGTTACATTCCTAGG - Intergenic
1102754528 12:115326790-115326812 TACAAATAAATTACCTGTCTTGG + Intergenic
1103303091 12:119943057-119943079 TATAAATGACTTTCCTGGCTGGG - Intergenic
1103761737 12:123255029-123255051 TATATATGAAACACCTGCCTTGG - Intronic
1104708773 12:130969918-130969940 TTTAAATGAATTGTCTTCTTTGG + Intronic
1105540870 13:21315356-21315378 TATAAATGTATTAGCTTCTTAGG - Intergenic
1105784407 13:23734410-23734432 GATGAATGAATTTCCTTTCTCGG - Intronic
1105907766 13:24830591-24830613 AATAAATAAATTACCTTCTCTGG - Exonic
1109257153 13:60097309-60097331 AATAGATTAATGACCTTCCTGGG + Intronic
1109345182 13:61107461-61107483 TGTAAATGAGTTACCTGCATTGG + Intergenic
1109842736 13:67941147-67941169 TAATAATAAATTACCTTTCTGGG - Intergenic
1111140785 13:84115324-84115346 AATAGATGAATTCCCTTTCTGGG + Intergenic
1112034204 13:95482679-95482701 TATAAATGAATAAACTGGCTGGG + Intronic
1112523522 13:100120582-100120604 TATAAATGAATTGTTTTCCTAGG - Intronic
1112885424 13:104164711-104164733 CTTAAATGAATTAACTTGCTGGG - Intergenic
1113495857 13:110728485-110728507 TATACAAGGATGACCTTCCTTGG + Intergenic
1113728954 13:112625986-112626008 AAGAAATGCATTAGCTTCCTCGG + Intergenic
1114260181 14:21030954-21030976 CATGAATGCATTACCTTCCAAGG - Intronic
1116044401 14:39726226-39726248 AACAAATGACTTTCCTTCCTAGG + Intergenic
1116120659 14:40718260-40718282 TATAATTCAATTACCTCCCATGG - Intergenic
1116416182 14:44680446-44680468 TATAAATGAATTCAGTTTCTTGG - Intergenic
1117562294 14:56953184-56953206 TAAAAATCAATTGCCATCCTTGG + Intergenic
1117649567 14:57889156-57889178 TATAAACGATTTGGCTTCCTGGG + Intronic
1117904906 14:60574664-60574686 TATAATTTAATTCCCTTCTTAGG - Intergenic
1117909724 14:60625478-60625500 TGTAAATGATTTACCATTCTTGG + Intergenic
1119851763 14:77871322-77871344 TATGAATGAATATCCTACCTTGG - Intronic
1120141755 14:80937379-80937401 TATAAATATTTTATCTTCCTAGG - Intronic
1120636505 14:86958434-86958456 TATAAATGAATTTCAGACCTTGG + Intergenic
1120737506 14:88069708-88069730 AATAGATGAATGACCTCCCTTGG + Intergenic
1120945700 14:89994712-89994734 TAGAAATGTATTGCCTTGCTGGG + Intronic
1121049906 14:90813523-90813545 TTTAAATGACTTACCTTGCAGGG - Intronic
1121697052 14:95922267-95922289 TCTCAATGAATCACCTTCCCTGG + Intergenic
1125382651 15:39103575-39103597 TATAAATGTATTACCTTATATGG - Intergenic
1125799765 15:42435143-42435165 TATTAATAATATACCTTCCTTGG - Intronic
1129993156 15:79982233-79982255 TATAAAGGAAGTCCCTTCCTTGG + Intergenic
1135197264 16:20404678-20404700 CAGAAATGAAGTCCCTTCCTGGG + Exonic
1135318895 16:21477434-21477456 TAAAAAGGAATTTCCTTCTTTGG - Intergenic
1135371790 16:21909227-21909249 TAAAAAGGAATTTCCTTCTTTGG - Intergenic
1135439997 16:22461477-22461499 TAAAAAGGAATTTCCTTCTTTGG + Intergenic
1136329199 16:29559500-29559522 TAAAAAGGAATTTCCTTCTTTGG - Intergenic
1136443830 16:30299212-30299234 TAAAAAGGAATTTCCTTCTTTGG - Intergenic
1137647010 16:50084283-50084305 TGAAAATGGATTACCTTCTTTGG - Exonic
1139089255 16:63624297-63624319 TGTAAAGTAATTACCTTCTTTGG + Intergenic
1139168333 16:64598283-64598305 TCTAAATGATTTACCTTCAGTGG + Intergenic
1139626188 16:68190632-68190654 TTTATATGAACTGCCTTCCTTGG + Intronic
1140465465 16:75177903-75177925 TACAAATGGATTAAATTCCTTGG + Intergenic
1140689312 16:77466445-77466467 TATACATGATTTTCCTTACTAGG - Intergenic
1143686555 17:8521934-8521956 GATAAATGACTAAGCTTCCTAGG + Intronic
1144722218 17:17479238-17479260 TATAAATGCCTAACCTTTCTAGG + Intronic
1144841036 17:18185885-18185907 TATTACTGAATTACATTACTAGG - Intronic
1145778548 17:27546379-27546401 GAAAAATTAATTATCTTCCTTGG + Intronic
1147508113 17:41040710-41040732 TGTAAATGAATTTACTTCCTAGG + Exonic
1150033682 17:61769678-61769700 TAAAAATCAATTACTTTTCTGGG + Intronic
1150846341 17:68662561-68662583 TATAAATGAACTAATTTGCTGGG - Intergenic
1151202835 17:72481364-72481386 TGTAAAGGAATGACATTCCTTGG + Intergenic
1153014627 18:572500-572522 TCTAAATGAAAAACCTCCCTGGG + Intergenic
1154062922 18:11080521-11080543 AATAAAGGGGTTACCTTCCTTGG + Intronic
1154132378 18:11748490-11748512 TATTAATATATTAACTTCCTGGG + Intronic
1155225259 18:23724392-23724414 TATCAATGAAAAAGCTTCCTTGG + Intronic
1155729230 18:29131353-29131375 TTTAAATGAATCTACTTCCTAGG + Intergenic
1158382298 18:56945891-56945913 TATAAATGAATAAACATCCAAGG - Intronic
1164905763 19:31966690-31966712 TATAAATGAATTACCTTCCTGGG + Intergenic
1165041646 19:33072343-33072365 AATAAATGAATTACAAGCCTGGG + Intergenic
1165369237 19:35392638-35392660 TATCGATGAATTACCTTCCCCGG + Intergenic
927362952 2:22258348-22258370 TATTAACCAATTCCCTTCCTTGG + Intergenic
928876826 2:36049732-36049754 TCTAATTGACTTACCTTCTTTGG - Intergenic
930648468 2:53938266-53938288 AATAAACCATTTACCTTCCTTGG + Intronic
931049940 2:58401294-58401316 TATATGTGAAATAGCTTCCTGGG - Intergenic
931485610 2:62688094-62688116 TAAAAATGAATTATCTCTCTTGG + Intronic
931519800 2:63083315-63083337 TATAAATAAATTAGATTCTTTGG + Intergenic
931534770 2:63262339-63262361 CATAAATGTATTGTCTTCCTAGG - Intronic
932513978 2:72325929-72325951 TATAAAAGAATTAACTACCTGGG - Intronic
933504802 2:83163228-83163250 TGTAAATGAGTTCCCTTACTTGG - Intergenic
937516164 2:122657748-122657770 AATAAATGAATTATTTTTCTGGG + Intergenic
939650625 2:144757781-144757803 TATAAGTAAATTACCTGCCATGG + Intergenic
939787476 2:146535492-146535514 TACCAATGAATTATCTTCCAAGG - Intergenic
940345460 2:152623806-152623828 TTTAAATGGATTACCTTTTTTGG + Intronic
941625000 2:167821733-167821755 GATAAAAAAAATACCTTCCTAGG - Intergenic
942069175 2:172299883-172299905 TAAAAATGAATTGCATTCCCAGG - Intergenic
942786130 2:179705037-179705059 TATGAATGAGATACCTTCCATGG - Intronic
943045716 2:182859740-182859762 AATTAATGAATTACTTTCCCAGG + Intronic
943085573 2:183306963-183306985 TAAATATGAATTACCTTTCAAGG - Intergenic
943559062 2:189439667-189439689 TACAAATGACTTATCTTTCTGGG + Intergenic
943853555 2:192759524-192759546 TAGAACAGAATTATCTTCCTCGG - Intergenic
945058516 2:205888491-205888513 TAACCTTGAATTACCTTCCTTGG - Intergenic
945543866 2:211124225-211124247 TATAAATGTATTACTTTACATGG - Intergenic
946129518 2:217595106-217595128 GATAAGTGAATTAATTTCCTAGG + Intronic
946677262 2:222173971-222173993 TAGAAATGAATTTTCTTCTTGGG - Intergenic
946737817 2:222772430-222772452 GATGGATGAATTACTTTCCTTGG + Intergenic
1169587728 20:7104893-7104915 TATATATCAATTACATTTCTGGG + Intergenic
1170263140 20:14434993-14435015 GATAACTGTATTACTTTCCTAGG + Intronic
1170905195 20:20508944-20508966 TACAATTGAATTAGCTCCCTGGG - Intronic
1171222424 20:23411277-23411299 TATAAATGAAGAACATTTCTGGG + Intronic
1172391462 20:34568100-34568122 AATAAATAAATTAGCTTCCCAGG + Intronic
1175610970 20:60351124-60351146 GATATTTGAAATACCTTCCTGGG - Intergenic
1176783118 21:13223248-13223270 TATAAGTGAAGTGCCTGCCTAGG + Intergenic
1176944631 21:14964439-14964461 TATAAAAGAATTTCATTCATAGG + Exonic
1177307889 21:19344126-19344148 TATAATTAAATAACCTTCCATGG - Intergenic
1177420722 21:20853255-20853277 TGTAAATGTGTTACCTTCCATGG - Intergenic
1182069086 22:27450796-27450818 TGTGAATGTATTACCTTCCATGG + Intergenic
1184392579 22:44212960-44212982 TATTAATGCATCACCTTTCTAGG - Intronic
949361051 3:3232517-3232539 TTAAAATGTTTTACCTTCCTAGG - Intergenic
949653302 3:6186746-6186768 TATGCATGAATTAACTTGCTGGG + Intergenic
949802329 3:7917410-7917432 TCTAAATGAATTAACCTGCTGGG + Intergenic
950461209 3:13123243-13123265 TAGAAATGAATTCCCTCCCCTGG - Intergenic
950644556 3:14369337-14369359 TATGACCCAATTACCTTCCTTGG - Intergenic
952537306 3:34324515-34324537 TAGAGATGAATTGCCTACCTAGG + Intergenic
952553145 3:34501663-34501685 TATCATTTAATTACCTTTCTTGG + Intergenic
953316836 3:41935787-41935809 CTTTCATGAATTACCTTCCTAGG + Exonic
953569581 3:44060540-44060562 AATAAAGCAATTAACTTCCTGGG - Intergenic
954570433 3:51636602-51636624 TATAACTGACTTGCATTCCTAGG - Intronic
954951194 3:54475342-54475364 AATAATTGAATTATCTCCCTGGG + Intronic
955178152 3:56638031-56638053 TATAAATGGCTTACCCTTCTTGG + Intronic
955892352 3:63663555-63663577 AATAAATGAATGCCCTGCCTTGG + Intronic
956218793 3:66879883-66879905 CATATAAGAATTACCTGCCTGGG + Intergenic
956638141 3:71386755-71386777 AAAAAAAGAATCACCTTCCTTGG + Intronic
956691946 3:71886780-71886802 TATAAATGAATGAGCATGCTGGG - Intergenic
956990981 3:74765046-74765068 AATAAATAAATTACCTTATTAGG + Intergenic
957872879 3:86110692-86110714 TTTACATGAATAACCTGCCTGGG - Intergenic
957984897 3:87561894-87561916 TATATAGGAATTTCATTCCTAGG - Intergenic
958112116 3:89162057-89162079 TTTAAGTGAATTACCTCACTTGG - Intronic
958707877 3:97678587-97678609 TATAATTAAATCACCTTTCTAGG - Intronic
959044630 3:101459553-101459575 TATAAATGACTTATTTGCCTAGG - Intronic
959598373 3:108152192-108152214 TAAAAATGTGTCACCTTCCTAGG + Intergenic
960061693 3:113329587-113329609 TATGAAAGAATAACCTTTCTTGG - Intronic
962501735 3:136001342-136001364 TATAAATGGTTTCCCTTCATGGG + Exonic
966374318 3:179280068-179280090 TAAAACTGAAACACCTTCCTGGG + Intergenic
966997007 3:185292668-185292690 TTTAAATCACCTACCTTCCTAGG - Intronic
967372794 3:188766697-188766719 TAAAAAAGAATTACCATCATGGG - Intronic
968302031 3:197624065-197624087 TATAAATGAATTTTTTGCCTTGG - Intergenic
968805010 4:2766635-2766657 TGTAAATGTGTTACCTTCCATGG + Intergenic
969862116 4:10045615-10045637 CATAAATGAAATACCATTCTTGG - Intronic
970495063 4:16616805-16616827 TATAAATGTATTATGTACCTAGG + Intronic
970777459 4:19693161-19693183 TGTAAATGCATTACCTTTCATGG + Intergenic
971762466 4:30784519-30784541 TTTAAATGCATTATATTCCTGGG + Intronic
972068875 4:34989028-34989050 TAGAAATGTGTTATCTTCCTAGG + Intergenic
972088267 4:35247513-35247535 TATAAATACAGTACATTCCTTGG + Intergenic
972887351 4:43509186-43509208 TATAAATGAATTTTCTTGCCTGG + Intergenic
973129197 4:46628907-46628929 TATTAATTAATTACATTCCCTGG + Intergenic
973669996 4:53207287-53207309 CAAAAATGTATTACATTCCTAGG - Intronic
975084940 4:70327446-70327468 TATAAATTTAATACTTTCCTTGG + Intergenic
975609739 4:76192064-76192086 TATAAAGAAATAACCTTCCTGGG - Intronic
976595419 4:86891259-86891281 TATAAGTTAATTATCTTACTTGG - Intronic
977007408 4:91586693-91586715 TTTAAAAGAATTGCCTTCTTTGG - Intronic
977169540 4:93743697-93743719 AATAAATTAATGCCCTTCCTTGG - Intronic
978837281 4:113166874-113166896 TATACATGAATTATTATCCTTGG - Intronic
980058530 4:128103430-128103452 AATGAATGAATTACCTGCCTTGG + Intronic
980921108 4:139086810-139086832 TATAAATAATTTAACATCCTTGG - Intronic
983048375 4:163013874-163013896 TATGAATAATTTCCCTTCCTTGG + Intergenic
984549366 4:181142645-181142667 TATAAATGCATTATCATCCATGG + Intergenic
984679260 4:182588199-182588221 TATAAATCAATTAACTTCTGAGG - Intronic
984904724 4:184615966-184615988 TTTAAAGGACTCACCTTCCTTGG + Intergenic
986155522 5:5171032-5171054 TATAAATGAATTTACTTTCTTGG + Intronic
986156579 5:5182672-5182694 TATAAATGAATTACCTCAGCAGG - Intronic
986787692 5:11130089-11130111 TATAAAGAAATTGCCTTCCTTGG - Intronic
986949790 5:13069551-13069573 AATATTTGAATTACCTTCCGTGG - Intergenic
986951965 5:13099504-13099526 TTGAAATAATTTACCTTCCTTGG - Intergenic
987103182 5:14610754-14610776 TATATAAGCATTACCTTCCCAGG + Exonic
987591806 5:19939063-19939085 TAAATATTAATTACCTTTCTTGG - Intronic
987604130 5:20110882-20110904 TTTAAAAAAATTAACTTCCTTGG + Intronic
988208341 5:28170383-28170405 TTCAAAAGAATTACCATCCTTGG - Intergenic
989566628 5:42907549-42907571 AGTAAAGGTATTACCTTCCTTGG - Intergenic
989926776 5:49888570-49888592 TAAAAAGGAAATATCTTCCTGGG + Intergenic
990346277 5:54874936-54874958 AATAAAATAATCACCTTCCTGGG - Intergenic
990788114 5:59445953-59445975 TATAAATGAATTCCCATGGTTGG + Intronic
992621356 5:78596544-78596566 TAAAAATGATTGACCTTCCTTGG + Intronic
993003750 5:82408905-82408927 TATACATCAATTACAATCCTAGG - Intergenic
993159528 5:84271527-84271549 TATAAATGATTTATGTGCCTTGG + Intronic
994488686 5:100412949-100412971 TATAAATGAATTGTTTTCATTGG - Intergenic
994827875 5:104739278-104739300 TATAAGTGGATTAACTTACTTGG + Intergenic
995064915 5:107850586-107850608 TATAAATGGAAAATCTTCCTAGG + Intergenic
998085030 5:139313549-139313571 TATAAATGAGTTAACTTTTTAGG - Intronic
999659445 5:153843649-153843671 TAAAACTGAATTATCTTCATAGG + Intergenic
1003667099 6:8121566-8121588 AATAGATGAATGCCCTTCCTTGG + Intergenic
1007973898 6:46080767-46080789 GATAAATGAATTACATGCCCTGG + Intergenic
1008286923 6:49664510-49664532 TTTTAATAAATTACCTTCCTAGG + Intergenic
1009372940 6:62930591-62930613 AATAAATGAATTAACTTCGATGG - Intergenic
1009376130 6:62971939-62971961 TCTAAATCAATTACATCCCTAGG + Intergenic
1010370728 6:75104116-75104138 TTTATGTGAATTACATTCCTTGG + Intronic
1010404302 6:75485476-75485498 TATAAAACATTCACCTTCCTGGG + Intronic
1010552522 6:77240047-77240069 TATAAAATAATTTCCTTCCTTGG - Intergenic
1012037995 6:94166978-94167000 TACAAATTTATTACATTCCTTGG - Intergenic
1013299322 6:108788607-108788629 TGTAAATGAACTAACTTCATAGG - Intergenic
1013952297 6:115798015-115798037 TAAAAATCAATTACTTTTCTTGG + Intergenic
1016871961 6:148826441-148826463 TTTAAATGAATTAACTACATAGG + Intronic
1019399289 7:842460-842482 TATAAATGCATTACTTTTGTAGG + Intronic
1020806975 7:12802168-12802190 TATAAATGAGTCATCATCCTGGG - Intergenic
1023094580 7:36647526-36647548 TATCATAGAAATACCTTCCTTGG + Intronic
1023753726 7:43396280-43396302 AATTAATCAATTGCCTTCCTCGG - Intronic
1026416349 7:70184804-70184826 TATAAATAAAGAACCTTCCCAGG - Intronic
1026607510 7:71828363-71828385 TATAAATGGGTTACCTTACATGG + Intronic
1027680574 7:81215365-81215387 TATAAAGGCATTACCTTCTGGGG - Intergenic
1027713498 7:81639502-81639524 TAGAAATGAAGTCCCTTCCAGGG + Intergenic
1031058540 7:117022351-117022373 TGAAAATGAATTGCCTTCTTTGG + Intronic
1031381469 7:121091267-121091289 AAGAAATGAATTCCTTTCCTGGG + Intronic
1032874381 7:136022003-136022025 TATAAATGAATTAACTTTATGGG - Intergenic
1032912150 7:136445111-136445133 TTTAAGTGGATTACCTTCTTTGG + Intergenic
1034072902 7:148204365-148204387 TATAGTTCATTTACCTTCCTTGG + Intronic
1035112346 7:156493630-156493652 TGTAAACAAATTACCTTCCCAGG - Intergenic
1037326967 8:17702106-17702128 AGTAAATAAATTACTTTCCTAGG + Intronic
1038162241 8:25050880-25050902 TATGTATGAATTAACTTCCGAGG + Intergenic
1039240738 8:35553765-35553787 AATAGATGCATTACCTCCCTTGG + Intronic
1039761442 8:40580743-40580765 TATAAATGACTTAATATCCTGGG + Intronic
1039960641 8:42244701-42244723 TATAAATGGATTAGCTACATTGG + Intergenic
1040355629 8:46615664-46615686 TATAAATGAAATATCTTCAAAGG - Intergenic
1040623398 8:49116055-49116077 TAAAAATGTATTAACTTCATAGG + Intergenic
1040752007 8:50721493-50721515 TATGAATAAATTGCTTTCCTGGG + Intronic
1043871019 8:85433007-85433029 TATAAATTATTTTCCTTCCTTGG - Intronic
1044245359 8:89937920-89937942 AAAAAAGGAATTAACTTCCTTGG - Intronic
1045127752 8:99112553-99112575 TATATTTGAATTAGCTTCTTTGG + Intronic
1046269298 8:111872261-111872283 GAAAAATAAATTAGCTTCCTGGG + Intergenic
1046602694 8:116335956-116335978 AATAAATGCTTTAGCTTCCTTGG - Intergenic
1046945414 8:119969752-119969774 TATCAATGAATTACTGTGCTGGG - Intronic
1047158909 8:122354126-122354148 TATAGGTGTATTAACTTCCTAGG - Intergenic
1047209221 8:122827360-122827382 TATTAATGAATAACAATCCTCGG - Intronic
1047612107 8:126531204-126531226 TAGAAGTGTATTACCTTCCTGGG + Intergenic
1048230524 8:132636094-132636116 AATAAATGTATTATTTTCCTAGG - Intronic
1049370950 8:142266676-142266698 CATACATGAAATACCTTCCTGGG - Intronic
1051330731 9:16022603-16022625 TATAAAGCAATTACATTCTTGGG - Intronic
1051676587 9:19564553-19564575 TATCAATCAATCACATTCCTAGG + Intronic
1051744806 9:20285385-20285407 TAGAATTAAATTGCCTTCCTTGG - Intergenic
1051941391 9:22509282-22509304 TATAAATCAATTATCTTTTTTGG - Intergenic
1052571607 9:30231745-30231767 TATAAATGAATAACCTGCTTAGG + Intergenic
1053519276 9:38761807-38761829 TAGAAATTAATTACTTTTCTTGG - Intergenic
1055387522 9:75778943-75778965 TATAAATAAATTAAATACCTAGG + Intergenic
1055684644 9:78758259-78758281 TCTAATTGAATTTCTTTCCTTGG + Intergenic
1058030037 9:100186025-100186047 TTTTAATGACTTACTTTCCTCGG + Intronic
1058203841 9:102077176-102077198 CATACATGTATTACTTTCCTAGG + Intergenic
1060456570 9:123804091-123804113 TATAATTCAATCACCTTCCACGG - Intronic
1062633169 9:137476281-137476303 TATGATTGAAGTTCCTTCCTTGG - Intronic
1203703739 Un_KI270742v1:17356-17378 TATAAATGAAATATCTTCAAAGG + Intergenic
1186164245 X:6809737-6809759 TTTATAAGAACTACCTTCCTTGG - Intergenic
1186578810 X:10794797-10794819 TATAAATTCATTACTTACCTAGG + Intronic
1187736128 X:22305361-22305383 AATAAATCAGTTATCTTCCTTGG - Intergenic
1191135861 X:57064206-57064228 TATAAATGATTGATTTTCCTCGG - Intergenic
1191653716 X:63572691-63572713 TATAAATTAATTATATTCTTAGG + Intergenic
1194341608 X:92712745-92712767 TATACATGAATTACTCTCTTTGG + Intergenic
1194461199 X:94170626-94170648 TATATATGAATCACCCTCCCTGG + Intergenic
1195397969 X:104431528-104431550 CATAAATCCATTAGCTTCCTAGG + Intergenic
1195454911 X:105057530-105057552 TATTAATGAATTATCTTTTTTGG + Intronic
1197095644 X:122591535-122591557 TAAAAATAAATAACCTTTCTTGG + Intergenic
1197492709 X:127138556-127138578 TTAAAATGTTTTACCTTCCTGGG - Intergenic
1198503950 X:137282312-137282334 TATGTATGAATTCCCTTGCTGGG + Intergenic
1199067387 X:143435750-143435772 TGTAACTGAATTACCTTAGTAGG - Intergenic
1199404555 X:147441985-147442007 TAAGAATGCCTTACCTTCCTGGG - Intergenic
1201894686 Y:18981067-18981089 TATAAATGCATAATATTCCTTGG - Intergenic