ID: 1164905764

View in Genome Browser
Species Human (GRCh38)
Location 19:31966694-31966716
Sequence AATGAATTACCTTCCTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164905760_1164905764 -1 Left 1164905760 19:31966672-31966694 CCCACTTAGCAAATTATGTATAA No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905754_1164905764 27 Left 1164905754 19:31966644-31966666 CCCGGCAGGTACATGGCCCCACT No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905758_1164905764 9 Left 1164905758 19:31966662-31966684 CCACTCTCGCCCCACTTAGCAAA No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905759_1164905764 0 Left 1164905759 19:31966671-31966693 CCCCACTTAGCAAATTATGTATA No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905755_1164905764 26 Left 1164905755 19:31966645-31966667 CCGGCAGGTACATGGCCCCACTC No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905756_1164905764 11 Left 1164905756 19:31966660-31966682 CCCCACTCTCGCCCCACTTAGCA No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905761_1164905764 -2 Left 1164905761 19:31966673-31966695 CCACTTAGCAAATTATGTATAAA No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126
1164905757_1164905764 10 Left 1164905757 19:31966661-31966683 CCCACTCTCGCCCCACTTAGCAA No data
Right 1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164905764 Original CRISPR AATGAATTACCTTCCTGGGC TGG Intergenic
902556329 1:17249025-17249047 AATGAATTGGCACCCTGGGCTGG + Intergenic
905469548 1:38181577-38181599 AATGATCTACCTGCCTTGGCTGG + Intergenic
906174190 1:43755561-43755583 AATGTATTTCCTTCCTGGGGTGG + Intronic
907975072 1:59423668-59423690 ACTGAATACCCTTCCTGGTCTGG + Intronic
908578518 1:65488409-65488431 ATTGAATCAACCTCCTGGGCTGG + Intronic
910777035 1:90887187-90887209 AATGAATTAGATTCATTGGCTGG - Intergenic
911528998 1:99021237-99021259 AATGACTTACCTAACTGGGAGGG + Intergenic
912485248 1:110021922-110021944 AAAGAATCACCTTTCTGGGCTGG - Exonic
915405407 1:155656405-155656427 AATGAATGATGTTCCTGGGCAGG + Intergenic
916423605 1:164659980-164660002 AATAAATTCCTTTCCTGGGTAGG + Intronic
919222909 1:194654613-194654635 AATGTATTACCTTCCAGTTCTGG + Intergenic
920552247 1:206872363-206872385 GATGGATTGGCTTCCTGGGCTGG - Intergenic
920597342 1:207285673-207285695 CATGAATTTCCTTCCATGGCTGG + Intergenic
1064770653 10:18719080-18719102 AAACAATTACCTCCCTGGGCAGG + Intergenic
1066006886 10:31153981-31154003 AATGATGCACCTTCATGGGCAGG + Intergenic
1067945113 10:50684338-50684360 AAGGCATGAGCTTCCTGGGCAGG - Intergenic
1070103734 10:73413246-73413268 AATGAGTTACCTTCCAGGCAAGG - Intronic
1071255163 10:83865890-83865912 AATGAAATTTCTTCCTTGGCTGG - Intergenic
1071268153 10:83982585-83982607 GATGAATTTCTTTTCTGGGCTGG + Intergenic
1073390666 10:103173797-103173819 CAAGAATTTCATTCCTGGGCTGG + Intronic
1075985263 10:126779560-126779582 AATGAAATAATTTCCAGGGCTGG - Intergenic
1076356407 10:129856920-129856942 AAGGAAATATCTTCCAGGGCCGG + Intronic
1077372416 11:2189515-2189537 TAAGAATGTCCTTCCTGGGCCGG - Intergenic
1077668357 11:4136513-4136535 AATAAAATACATTCCTGGCCAGG - Intronic
1078450832 11:11439460-11439482 GACCAATTCCCTTCCTGGGCTGG + Intronic
1083644584 11:64165160-64165182 ACAGAGTGACCTTCCTGGGCTGG - Intronic
1085705859 11:78786405-78786427 AATGCATTATCTTGCTGGGATGG - Intronic
1086496483 11:87409624-87409646 AATTAATTTCCTTCATGGGAGGG - Intergenic
1089630433 11:119781008-119781030 ATTGAGTGACCTCCCTGGGCCGG + Intergenic
1089921521 11:122213549-122213571 ATTGAATGACCTCCCTGGGGTGG + Intergenic
1092907908 12:13118796-13118818 AAAGACATACATTCCTGGGCTGG + Intronic
1093397258 12:18698502-18698524 AATGATTAACCTTATTGGGCTGG - Intronic
1093512829 12:19949243-19949265 TATGAATTGATTTCCTGGGCTGG - Intergenic
1094583645 12:31757413-31757435 AATGAATTCCCTCCCTGTTCAGG - Intergenic
1095596271 12:43962161-43962183 AAAGTATTACCTTCCTGACCTGG - Intronic
1097590441 12:61567836-61567858 AATTAAATACCTCCCTGGGGAGG - Intergenic
1101706980 12:107229934-107229956 ACTGAATCAGCTTCCTGGGGAGG + Intergenic
1104609416 12:130216274-130216296 CATGCATGCCCTTCCTGGGCAGG - Intergenic
1106061336 13:26295566-26295588 AATGAGTTATTGTCCTGGGCAGG + Intronic
1107095826 13:36534028-36534050 AATGGGTTGGCTTCCTGGGCAGG + Intergenic
1107984319 13:45761948-45761970 AATGAGTTGCCTGACTGGGCTGG - Intergenic
1108362112 13:49677321-49677343 TCTGAATGACCTTCCTGGGGTGG - Intronic
1108368717 13:49745651-49745673 ATTGAATTACCATCTTGGGCTGG - Intronic
1109197383 13:59393138-59393160 AATGAAAAAGCTTCTTGGGCAGG + Intergenic
1109257155 13:60097313-60097335 GATTAATGACCTTCCTGGGGTGG + Intronic
1110195086 13:72780030-72780052 AAAGAATTATATTCCTGGCCAGG + Intronic
1111140787 13:84115328-84115350 GATGAATTCCCTTTCTGGGAGGG + Intergenic
1112919820 13:104598267-104598289 AAGGAATTAACTTTATGGGCTGG + Intergenic
1115129288 14:30034388-30034410 CAGTAATTACTTTCCTGGGCTGG - Intronic
1117134575 14:52721758-52721780 AATAAATTACCTTCTTGGTAAGG - Intronic
1122472039 14:101975358-101975380 AATGAATGAGCTTCCTGGGATGG + Intronic
1126015241 15:44344474-44344496 AATGAATTACCTTCTTGACCTGG + Intronic
1132180484 15:99749230-99749252 AATGAAGTGTCCTCCTGGGCCGG - Intergenic
1133417615 16:5618749-5618771 CCTGATTTACCTTCCTGAGCTGG - Intergenic
1139335840 16:66230598-66230620 AATGAATTAACTTCCAGGTGGGG - Intergenic
1140130935 16:72160673-72160695 ACTGAATTAATTTCCTGGGGAGG + Intronic
1140524192 16:75608743-75608765 GGTGAACTACCTTCCTAGGCTGG + Intronic
1146383945 17:32352854-32352876 AATGAAATACAATTCTGGGCTGG - Intronic
1147650237 17:42057959-42057981 AATGAAAGGGCTTCCTGGGCAGG + Intronic
1147681770 17:42253179-42253201 ACTGAATTATCTTCCTGAGTTGG - Intronic
1149773429 17:59339217-59339239 AATGAATTAACTTTCAGGACAGG + Intronic
1154132462 18:11749336-11749358 AATGAATTACTTTTCTAGACAGG - Intronic
1157535616 18:48455397-48455419 GTTGAATTACCTGCCTGGCCTGG + Intergenic
1163927714 19:20361572-20361594 AATGAATTACCTTCATCCACAGG - Intergenic
1164905764 19:31966694-31966716 AATGAATTACCTTCCTGGGCTGG + Intergenic
1165161910 19:33821214-33821236 GATGAATTCCCTCCCTGGGCTGG - Intergenic
925268386 2:2583429-2583451 AATGAATGAACTTCCTCGGCAGG + Intergenic
926706086 2:15838569-15838591 GATGAATGTCATTCCTGGGCAGG - Intergenic
927130591 2:20055395-20055417 AATAATTTAGCTTCCTGGCCAGG + Intergenic
928824029 2:35396853-35396875 AATGAATTTCAATCCTGTGCAGG - Intergenic
929099383 2:38294983-38295005 ATTGAATTCCCTTGGTGGGCGGG + Exonic
930063977 2:47313584-47313606 AATGAATGAACTTCCTGGATTGG + Intergenic
930853601 2:55988134-55988156 ATTAAATTACATTTCTGGGCCGG - Intergenic
930931119 2:56885353-56885375 AATAAGCTAGCTTCCTGGGCTGG - Intergenic
932262548 2:70338770-70338792 AATGACTTACCATCTTGGGCAGG + Intergenic
934863277 2:97782083-97782105 AATGAACGCCCTTCCTGGCCAGG + Intronic
936774567 2:115957229-115957251 ACTGAAATACATTCCTGGCCGGG - Intergenic
941624999 2:167821729-167821751 AAAAAAATACCTTCCTAGGCTGG - Intergenic
942412884 2:175729889-175729911 AATGACTGACTTTCCTGGGTGGG - Intergenic
944505879 2:200410317-200410339 TGTTAATGACCTTCCTGGGCTGG + Intronic
947450714 2:230206021-230206043 AGTAAGTGACCTTCCTGGGCAGG - Intronic
948492604 2:238322712-238322734 AAAGAATTGCCTTCTTGGCCAGG + Intronic
1172700320 20:36849637-36849659 AGTGATTTACCAGCCTGGGCTGG + Intronic
1172944701 20:38678112-38678134 AATTAATTTCCTTCTTGGCCAGG + Intergenic
1174150487 20:48482891-48482913 AATAATTTCCCTTCCTGGCCGGG - Intergenic
1175265812 20:57702969-57702991 AATGACTTACCAGCCAGGGCAGG - Intronic
1175820098 20:61904440-61904462 GATGAAACACCTGCCTGGGCTGG + Intronic
1177868923 21:26546860-26546882 AATGAACTTCCTCCCTGAGCTGG - Intronic
1183197783 22:36365255-36365277 AATGAGCTACCTTCCTGGGGTGG - Intronic
1183838765 22:40479895-40479917 AATGAAGTAGGTTCCTGGGCTGG + Intronic
949570713 3:5290060-5290082 GAGTAATTACCTTCCTAGGCTGG + Intergenic
953136597 3:40187443-40187465 AATTAATTTCCTCCCTGAGCAGG + Intronic
960426712 3:117517100-117517122 AATGAAATTCCTTCTTGGGTAGG - Intergenic
962212958 3:133494515-133494537 AATGTATTAGTTTCCTAGGCCGG + Intergenic
963845638 3:150154243-150154265 AATTAATAACCTTCCAGGCCAGG + Intergenic
967808772 3:193737594-193737616 AATGATTTAGCTACCTGGCCGGG + Intergenic
973587908 4:52410736-52410758 AATCAGTTGGCTTCCTGGGCTGG + Intergenic
975084157 4:70317346-70317368 AATGCAGTACCTTCCAGAGCAGG - Intergenic
978083589 4:104622911-104622933 AATGACTTAGCTTGCTGGTCAGG + Intergenic
978975032 4:114858912-114858934 AATGAGTTACCATCCTGGTAGGG + Intronic
983302683 4:165947348-165947370 AACGTATTACTTTCCTTGGCTGG + Intronic
985271900 4:188201520-188201542 AAAGAATTCCCTTCCTAGTCAGG + Intergenic
986014466 5:3746067-3746089 ACAGAACTACCTCCCTGGGCAGG + Intergenic
986649546 5:9949573-9949595 AATGAGTTGGTTTCCTGGGCAGG + Intergenic
987156398 5:15094069-15094091 AATGAACTATTTTCATGGGCAGG + Intergenic
988143539 5:27274351-27274373 GATGAAATACATTCCTGAGCAGG - Intergenic
997824754 5:137096463-137096485 AGTGAAATGCCATCCTGGGCTGG + Intronic
998670759 5:144350271-144350293 AATTAATTACTTTCCAGGGCAGG + Intronic
999117890 5:149180437-149180459 AATGAGTTGGCTTCCAGGGCAGG + Intronic
1003931651 6:10929636-10929658 CAGAAATTACCCTCCTGGGCTGG + Intronic
1005781443 6:29196961-29196983 AATGAATTACATTCATGGCTAGG + Intergenic
1006964434 6:37968239-37968261 AATGAGATACGTTCCTGGGGAGG + Intronic
1006971505 6:38050248-38050270 AATGAATTGCCTTCTTGGCCAGG - Intronic
1007264216 6:40585222-40585244 AAATAATTACATTCCTGGTCAGG + Intronic
1010864452 6:80957149-80957171 AATGAGTTGGCTTCCTGGACTGG - Intergenic
1010880982 6:81171401-81171423 ACTGAAGTACTTTACTGGGCAGG - Intergenic
1012582250 6:100883073-100883095 ACTGAATTTCCTTCCAGGCCAGG - Intergenic
1014830460 6:126097227-126097249 AATGACTTCCCTTCCTGGGAAGG + Intergenic
1018189857 6:161301192-161301214 AAAGTCTTAGCTTCCTGGGCTGG + Intergenic
1024945954 7:54807598-54807620 AGTGAATTAATTCCCTGGGCTGG + Intergenic
1025781450 7:64605276-64605298 AATGAGTCACCATCCCGGGCCGG - Intergenic
1025950909 7:66144851-66144873 TAGGAATTACCGTCCTGGGCCGG + Intronic
1026832114 7:73616549-73616571 AAGAAATGACCTTCCTGGGCTGG + Intronic
1027931061 7:84535747-84535769 AATTAATTACCTTCCAGCCCAGG - Intergenic
1027959947 7:84932428-84932450 AATGATTTGACTTCCTGTGCAGG - Intergenic
1032276119 7:130457081-130457103 AAATAATAACCTTCCTGGCCAGG + Intergenic
1033413917 7:141145753-141145775 ACTGAATTGCCTTCAGGGGCTGG + Intronic
1034190692 7:149211066-149211088 AATGAAAGGCCTTCCTGGTCAGG - Intronic
1036398474 8:8387484-8387506 AATAAACTGCCTTCCTGGGGAGG - Intergenic
1044203496 8:89464018-89464040 AGTAAATTGGCTTCCTGGGCTGG + Intergenic
1044586228 8:93871520-93871542 AAAGAATTTCGTTCCTTGGCAGG - Intronic
1044668697 8:94656515-94656537 AAAGAGTTACCTTTATGGGCCGG - Intronic
1045330189 8:101149125-101149147 AATGAATTACATGCCTAGTCAGG + Intergenic
1045988479 8:108278091-108278113 AATGATTTATTTTCCTAGGCTGG - Intronic
1047851011 8:128858097-128858119 AATAAATTGCTTGCCTGGGCCGG - Intergenic
1047951614 8:129939906-129939928 AAGGATTTACCTTGCGGGGCGGG - Intronic
1049720426 8:144113011-144113033 AGTCAATTACCCACCTGGGCAGG - Intronic
1051269341 9:15340225-15340247 AATGCAATACCTTCTTAGGCTGG - Intergenic
1055066821 9:72127340-72127362 AAAGAAAATCCTTCCTGGGCTGG + Intronic
1055238031 9:74148033-74148055 AAGGGATTACATTCCTGGCCAGG - Intergenic
1057494648 9:95551795-95551817 AAAAAAATGCCTTCCTGGGCTGG + Intergenic
1058360752 9:104143390-104143412 AGTGACTTCCCTTCCTGGACTGG + Intergenic
1059949242 9:119444758-119444780 AATCAATTACCTACCTAGACAGG - Intergenic
1060302556 9:122383775-122383797 AGGGAATGACCTTCCAGGGCAGG - Intronic
1188833163 X:34925801-34925823 AATGAATTACATTTCTGGCCAGG - Intergenic