ID: 1164907634

View in Genome Browser
Species Human (GRCh38)
Location 19:31980308-31980330
Sequence TGGAACAGTCGGAAGAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164907634_1164907636 -9 Left 1164907634 19:31980308-31980330 CCATCATTCTTCCGACTGTTCCA No data
Right 1164907636 19:31980322-31980344 ACTGTTCCATGTTTCCCAAGAGG No data
1164907634_1164907642 23 Left 1164907634 19:31980308-31980330 CCATCATTCTTCCGACTGTTCCA No data
Right 1164907642 19:31980354-31980376 CTAAAGCACTGCTCTATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164907634 Original CRISPR TGGAACAGTCGGAAGAATGA TGG (reversed) Intergenic
No off target data available for this crispr