ID: 1164908644

View in Genome Browser
Species Human (GRCh38)
Location 19:31987670-31987692
Sequence GAGTCGGGATCACAAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164908644_1164908648 -8 Left 1164908644 19:31987670-31987692 CCACTGGCTTGTGATCCCGACTC No data
Right 1164908648 19:31987685-31987707 CCCGACTCACATCAAGGTACGGG No data
1164908644_1164908646 -9 Left 1164908644 19:31987670-31987692 CCACTGGCTTGTGATCCCGACTC No data
Right 1164908646 19:31987684-31987706 TCCCGACTCACATCAAGGTACGG No data
1164908644_1164908651 11 Left 1164908644 19:31987670-31987692 CCACTGGCTTGTGATCCCGACTC No data
Right 1164908651 19:31987704-31987726 CGGGCCAGGTTTGATCCTCCTGG No data
1164908644_1164908650 -3 Left 1164908644 19:31987670-31987692 CCACTGGCTTGTGATCCCGACTC No data
Right 1164908650 19:31987690-31987712 CTCACATCAAGGTACGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164908644 Original CRISPR GAGTCGGGATCACAAGCCAG TGG (reversed) Intergenic