ID: 1164908784

View in Genome Browser
Species Human (GRCh38)
Location 19:31988865-31988887
Sequence ATCCATGGGAGGCCAGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164908775_1164908784 16 Left 1164908775 19:31988826-31988848 CCATCCTCTAAACAAAGTCTTTC No data
Right 1164908784 19:31988865-31988887 ATCCATGGGAGGCCAGGTGGAGG No data
1164908780_1164908784 -10 Left 1164908780 19:31988852-31988874 CCAGAGGACTCTCATCCATGGGA No data
Right 1164908784 19:31988865-31988887 ATCCATGGGAGGCCAGGTGGAGG No data
1164908776_1164908784 12 Left 1164908776 19:31988830-31988852 CCTCTAAACAAAGTCTTTCAAAC No data
Right 1164908784 19:31988865-31988887 ATCCATGGGAGGCCAGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164908784 Original CRISPR ATCCATGGGAGGCCAGGTGG AGG Intergenic
No off target data available for this crispr