ID: 1164911534

View in Genome Browser
Species Human (GRCh38)
Location 19:32016230-32016252
Sequence CATCAGAGGGACCCAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164911527_1164911534 -7 Left 1164911527 19:32016214-32016236 CCATAATTCCCTGTGTCATCAGA No data
Right 1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG No data
1164911522_1164911534 20 Left 1164911522 19:32016187-32016209 CCCCATCCAAATCTAGAATTGTA No data
Right 1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG No data
1164911526_1164911534 -6 Left 1164911526 19:32016213-32016235 CCCATAATTCCCTGTGTCATCAG No data
Right 1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG No data
1164911523_1164911534 19 Left 1164911523 19:32016188-32016210 CCCATCCAAATCTAGAATTGTAG No data
Right 1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG No data
1164911524_1164911534 18 Left 1164911524 19:32016189-32016211 CCATCCAAATCTAGAATTGTAGC No data
Right 1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG No data
1164911525_1164911534 14 Left 1164911525 19:32016193-32016215 CCAAATCTAGAATTGTAGCTCCC 0: 2
1: 40
2: 127
3: 226
4: 785
Right 1164911534 19:32016230-32016252 CATCAGAGGGACCCAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164911534 Original CRISPR CATCAGAGGGACCCAGTGGG AGG Intergenic
No off target data available for this crispr