ID: 1164912688

View in Genome Browser
Species Human (GRCh38)
Location 19:32025595-32025617
Sequence TAGGCCCAGCTGAAGGTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164912688_1164912690 -9 Left 1164912688 19:32025595-32025617 CCGCAGACCTTCAGCTGGGCCTA No data
Right 1164912690 19:32025609-32025631 CTGGGCCTAGATCAGAAACCTGG No data
1164912688_1164912696 30 Left 1164912688 19:32025595-32025617 CCGCAGACCTTCAGCTGGGCCTA No data
Right 1164912696 19:32025648-32025670 ATCTCCGTAACACATGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164912688 Original CRISPR TAGGCCCAGCTGAAGGTCTG CGG (reversed) Intergenic
No off target data available for this crispr