ID: 1164913080

View in Genome Browser
Species Human (GRCh38)
Location 19:32027862-32027884
Sequence CTGAAAATGCAGAAGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164913074_1164913080 0 Left 1164913074 19:32027839-32027861 CCTCCTGGATACTCCATCTGGAC No data
Right 1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG No data
1164913075_1164913080 -3 Left 1164913075 19:32027842-32027864 CCTGGATACTCCATCTGGACCTG No data
Right 1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG No data
1164913071_1164913080 15 Left 1164913071 19:32027824-32027846 CCTCTCATGGCAGCACCTCCTGG No data
Right 1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164913080 Original CRISPR CTGAAAATGCAGAAGGAACA GGG Intergenic
No off target data available for this crispr