ID: 1164913080 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:32027862-32027884 |
| Sequence | CTGAAAATGCAGAAGGAACA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1164913074_1164913080 | 0 | Left | 1164913074 | 19:32027839-32027861 | CCTCCTGGATACTCCATCTGGAC | No data | ||
| Right | 1164913080 | 19:32027862-32027884 | CTGAAAATGCAGAAGGAACAGGG | No data | ||||
| 1164913075_1164913080 | -3 | Left | 1164913075 | 19:32027842-32027864 | CCTGGATACTCCATCTGGACCTG | No data | ||
| Right | 1164913080 | 19:32027862-32027884 | CTGAAAATGCAGAAGGAACAGGG | No data | ||||
| 1164913071_1164913080 | 15 | Left | 1164913071 | 19:32027824-32027846 | CCTCTCATGGCAGCACCTCCTGG | No data | ||
| Right | 1164913080 | 19:32027862-32027884 | CTGAAAATGCAGAAGGAACAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1164913080 | Original CRISPR | CTGAAAATGCAGAAGGAACA GGG | Intergenic | ||
| No off target data available for this crispr | |||||