ID: 1164920183

View in Genome Browser
Species Human (GRCh38)
Location 19:32083458-32083480
Sequence TCCTGATTACTGGAGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164920183_1164920191 12 Left 1164920183 19:32083458-32083480 CCCCTTGGCTCCAGTAATCAGGA No data
Right 1164920191 19:32083493-32083515 CCCACTGAAGACCCAGGGACCGG No data
1164920183_1164920189 7 Left 1164920183 19:32083458-32083480 CCCCTTGGCTCCAGTAATCAGGA No data
Right 1164920189 19:32083488-32083510 AAAAGCCCACTGAAGACCCAGGG No data
1164920183_1164920188 6 Left 1164920183 19:32083458-32083480 CCCCTTGGCTCCAGTAATCAGGA No data
Right 1164920188 19:32083487-32083509 CAAAAGCCCACTGAAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164920183 Original CRISPR TCCTGATTACTGGAGCCAAG GGG (reversed) Intergenic
No off target data available for this crispr