ID: 1164922885

View in Genome Browser
Species Human (GRCh38)
Location 19:32102879-32102901
Sequence GGGGCACTGACAGTCTTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164922885_1164922894 26 Left 1164922885 19:32102879-32102901 CCTGGGAAGACTGTCAGTGCCCC No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164922885 Original CRISPR GGGGCACTGACAGTCTTCCC AGG (reversed) Intergenic
No off target data available for this crispr