ID: 1164922894

View in Genome Browser
Species Human (GRCh38)
Location 19:32102928-32102950
Sequence TTCCTGCCATTCTCCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164922885_1164922894 26 Left 1164922885 19:32102879-32102901 CCTGGGAAGACTGTCAGTGCCCC No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data
1164922887_1164922894 6 Left 1164922887 19:32102899-32102921 CCCTGATGCCCTGCGCCTCCCTC No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data
1164922891_1164922894 -9 Left 1164922891 19:32102914-32102936 CCTCCCTCACAATTTTCCTGCCA No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data
1164922888_1164922894 5 Left 1164922888 19:32102900-32102922 CCTGATGCCCTGCGCCTCCCTCA No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data
1164922889_1164922894 -2 Left 1164922889 19:32102907-32102929 CCCTGCGCCTCCCTCACAATTTT No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data
1164922886_1164922894 7 Left 1164922886 19:32102898-32102920 CCCCTGATGCCCTGCGCCTCCCT No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data
1164922890_1164922894 -3 Left 1164922890 19:32102908-32102930 CCTGCGCCTCCCTCACAATTTTC No data
Right 1164922894 19:32102928-32102950 TTCCTGCCATTCTCCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164922894 Original CRISPR TTCCTGCCATTCTCCCACCC TGG Intergenic
No off target data available for this crispr