ID: 1164924054

View in Genome Browser
Species Human (GRCh38)
Location 19:32112809-32112831
Sequence CCACCATGCCTGGCTAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164924046_1164924054 17 Left 1164924046 19:32112769-32112791 CCCATCTTAGCCTCTGGAGCAGT No data
Right 1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG No data
1164924050_1164924054 7 Left 1164924050 19:32112779-32112801 CCTCTGGAGCAGTGGGACTACAG No data
Right 1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG No data
1164924047_1164924054 16 Left 1164924047 19:32112770-32112792 CCATCTTAGCCTCTGGAGCAGTG No data
Right 1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164924054 Original CRISPR CCACCATGCCTGGCTAACAC TGG Intergenic
No off target data available for this crispr