ID: 1164927353

View in Genome Browser
Species Human (GRCh38)
Location 19:32140635-32140657
Sequence CAGAGTAAACAGCAGGTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164927347_1164927353 12 Left 1164927347 19:32140600-32140622 CCAATGGCAGCTGCTGTGTCTCC No data
Right 1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG No data
1164927344_1164927353 29 Left 1164927344 19:32140583-32140605 CCTCCGAGAGAAGATCTCCAATG No data
Right 1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG No data
1164927346_1164927353 26 Left 1164927346 19:32140586-32140608 CCGAGAGAAGATCTCCAATGGCA No data
Right 1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG No data
1164927350_1164927353 -9 Left 1164927350 19:32140621-32140643 CCACTGGGCAGCATCAGAGTAAA No data
Right 1164927353 19:32140635-32140657 CAGAGTAAACAGCAGGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164927353 Original CRISPR CAGAGTAAACAGCAGGTTCT GGG Intergenic
No off target data available for this crispr