ID: 1164927835

View in Genome Browser
Species Human (GRCh38)
Location 19:32144109-32144131
Sequence CATCCTTAAATGTCCTAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164927831_1164927835 -10 Left 1164927831 19:32144096-32144118 CCCCTCCTGTGTGCATCCTTAAA No data
Right 1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG No data
1164927830_1164927835 -9 Left 1164927830 19:32144095-32144117 CCCCCTCCTGTGTGCATCCTTAA No data
Right 1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG No data
1164927827_1164927835 -2 Left 1164927827 19:32144088-32144110 CCCCAGACCCCCTCCTGTGTGCA No data
Right 1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG No data
1164927826_1164927835 -1 Left 1164927826 19:32144087-32144109 CCCCCAGACCCCCTCCTGTGTGC No data
Right 1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG No data
1164927829_1164927835 -4 Left 1164927829 19:32144090-32144112 CCAGACCCCCTCCTGTGTGCATC No data
Right 1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG No data
1164927828_1164927835 -3 Left 1164927828 19:32144089-32144111 CCCAGACCCCCTCCTGTGTGCAT No data
Right 1164927835 19:32144109-32144131 CATCCTTAAATGTCCTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164927835 Original CRISPR CATCCTTAAATGTCCTAATG AGG Intergenic
No off target data available for this crispr