ID: 1164945295

View in Genome Browser
Species Human (GRCh38)
Location 19:32288254-32288276
Sequence GTGGATCAGGAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164945295_1164945303 13 Left 1164945295 19:32288254-32288276 CCTTCTTCCTTCTCCTGATCCAC No data
Right 1164945303 19:32288290-32288312 GCTTTCAGCAGAAGCGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164945295 Original CRISPR GTGGATCAGGAGAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr