ID: 1164947606

View in Genome Browser
Species Human (GRCh38)
Location 19:32309707-32309729
Sequence GATTTTGCAGAGAAGGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947606_1164947610 -4 Left 1164947606 19:32309707-32309729 CCGAGGGCCTTCTCTGCAAAATC No data
Right 1164947610 19:32309726-32309748 AATCCACAACCAGGCGCCCAGGG No data
1164947606_1164947612 -1 Left 1164947606 19:32309707-32309729 CCGAGGGCCTTCTCTGCAAAATC No data
Right 1164947612 19:32309729-32309751 CCACAACCAGGCGCCCAGGGCGG No data
1164947606_1164947609 -5 Left 1164947606 19:32309707-32309729 CCGAGGGCCTTCTCTGCAAAATC No data
Right 1164947609 19:32309725-32309747 AAATCCACAACCAGGCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947606 Original CRISPR GATTTTGCAGAGAAGGCCCT CGG (reversed) Intergenic
No off target data available for this crispr