ID: 1164947609

View in Genome Browser
Species Human (GRCh38)
Location 19:32309725-32309747
Sequence AAATCCACAACCAGGCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947605_1164947609 -4 Left 1164947605 19:32309706-32309728 CCCGAGGGCCTTCTCTGCAAAAT No data
Right 1164947609 19:32309725-32309747 AAATCCACAACCAGGCGCCCAGG No data
1164947606_1164947609 -5 Left 1164947606 19:32309707-32309729 CCGAGGGCCTTCTCTGCAAAATC No data
Right 1164947609 19:32309725-32309747 AAATCCACAACCAGGCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947609 Original CRISPR AAATCCACAACCAGGCGCCC AGG Intergenic
No off target data available for this crispr