ID: 1164947610

View in Genome Browser
Species Human (GRCh38)
Location 19:32309726-32309748
Sequence AATCCACAACCAGGCGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947605_1164947610 -3 Left 1164947605 19:32309706-32309728 CCCGAGGGCCTTCTCTGCAAAAT No data
Right 1164947610 19:32309726-32309748 AATCCACAACCAGGCGCCCAGGG No data
1164947606_1164947610 -4 Left 1164947606 19:32309707-32309729 CCGAGGGCCTTCTCTGCAAAATC No data
Right 1164947610 19:32309726-32309748 AATCCACAACCAGGCGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947610 Original CRISPR AATCCACAACCAGGCGCCCA GGG Intergenic
No off target data available for this crispr