ID: 1164947611

View in Genome Browser
Species Human (GRCh38)
Location 19:32309729-32309751
Sequence CCGCCCTGGGCGCCTGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947611_1164947617 11 Left 1164947611 19:32309729-32309751 CCACAACCAGGCGCCCAGGGCGG No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947611 Original CRISPR CCGCCCTGGGCGCCTGGTTG TGG (reversed) Intergenic