ID: 1164947613

View in Genome Browser
Species Human (GRCh38)
Location 19:32309735-32309757
Sequence ATGTATCCGCCCTGGGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947613_1164947624 26 Left 1164947613 19:32309735-32309757 CCAGGCGCCCAGGGCGGATACAT No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947613_1164947617 5 Left 1164947613 19:32309735-32309757 CCAGGCGCCCAGGGCGGATACAT No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947613 Original CRISPR ATGTATCCGCCCTGGGCGCC TGG (reversed) Intergenic