ID: 1164947614

View in Genome Browser
Species Human (GRCh38)
Location 19:32309742-32309764
Sequence GTTCTGGATGTATCCGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947614_1164947625 24 Left 1164947614 19:32309742-32309764 CCCAGGGCGGATACATCCAGAAC No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947614_1164947617 -2 Left 1164947614 19:32309742-32309764 CCCAGGGCGGATACATCCAGAAC No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data
1164947614_1164947626 25 Left 1164947614 19:32309742-32309764 CCCAGGGCGGATACATCCAGAAC No data
Right 1164947626 19:32309790-32309812 AGCTCAGTCTAAACTGGCCCGGG No data
1164947614_1164947624 19 Left 1164947614 19:32309742-32309764 CCCAGGGCGGATACATCCAGAAC No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947614 Original CRISPR GTTCTGGATGTATCCGCCCT GGG (reversed) Intergenic