ID: 1164947616

View in Genome Browser
Species Human (GRCh38)
Location 19:32309758-32309780
Sequence GACAGGGGAGTGGCAGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947616_1164947626 9 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947626 19:32309790-32309812 AGCTCAGTCTAAACTGGCCCGGG No data
1164947616_1164947627 17 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947616_1164947628 21 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947628 19:32309802-32309824 ACTGGCCCGGGACCTCCGGAAGG No data
1164947616_1164947625 8 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947616_1164947624 3 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947616 Original CRISPR GACAGGGGAGTGGCAGGTTC TGG (reversed) Intergenic