ID: 1164947617

View in Genome Browser
Species Human (GRCh38)
Location 19:32309763-32309785
Sequence ACCTGCCACTCCCCTGTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947607_1164947617 26 Left 1164947607 19:32309714-32309736 CCTTCTCTGCAAAATCCACAACC No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data
1164947613_1164947617 5 Left 1164947613 19:32309735-32309757 CCAGGCGCCCAGGGCGGATACAT No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data
1164947611_1164947617 11 Left 1164947611 19:32309729-32309751 CCACAACCAGGCGCCCAGGGCGG No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data
1164947614_1164947617 -2 Left 1164947614 19:32309742-32309764 CCCAGGGCGGATACATCCAGAAC No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data
1164947615_1164947617 -3 Left 1164947615 19:32309743-32309765 CCAGGGCGGATACATCCAGAACC No data
Right 1164947617 19:32309763-32309785 ACCTGCCACTCCCCTGTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947617 Original CRISPR ACCTGCCACTCCCCTGTCGC CGG Intergenic