ID: 1164947618

View in Genome Browser
Species Human (GRCh38)
Location 19:32309764-32309786
Sequence GCCGGCGACAGGGGAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947618_1164947625 2 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947618_1164947624 -3 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947618_1164947627 11 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947618_1164947628 15 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947628 19:32309802-32309824 ACTGGCCCGGGACCTCCGGAAGG No data
1164947618_1164947626 3 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947626 19:32309790-32309812 AGCTCAGTCTAAACTGGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947618 Original CRISPR GCCGGCGACAGGGGAGTGGC AGG (reversed) Intergenic