ID: 1164947619

View in Genome Browser
Species Human (GRCh38)
Location 19:32309768-32309790
Sequence TGCTGCCGGCGACAGGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947619_1164947627 7 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947619_1164947625 -2 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947619_1164947633 28 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947633 19:32309819-32309841 GGAAGGTGCAGTCTGCAGAGCGG No data
1164947619_1164947624 -7 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947619_1164947634 29 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947634 19:32309820-32309842 GAAGGTGCAGTCTGCAGAGCGGG No data
1164947619_1164947626 -1 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947626 19:32309790-32309812 AGCTCAGTCTAAACTGGCCCGGG No data
1164947619_1164947628 11 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947628 19:32309802-32309824 ACTGGCCCGGGACCTCCGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947619 Original CRISPR TGCTGCCGGCGACAGGGGAG TGG (reversed) Intergenic