ID: 1164947624

View in Genome Browser
Species Human (GRCh38)
Location 19:32309784-32309806
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947616_1164947624 3 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947614_1164947624 19 Left 1164947614 19:32309742-32309764 CCCAGGGCGGATACATCCAGAAC No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947618_1164947624 -3 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947613_1164947624 26 Left 1164947613 19:32309735-32309757 CCAGGCGCCCAGGGCGGATACAT No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947615_1164947624 18 Left 1164947615 19:32309743-32309765 CCAGGGCGGATACATCCAGAACC No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data
1164947619_1164947624 -7 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947624 19:32309784-32309806 GGCAGCAGCTCAGTCTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947624 Original CRISPR GGCAGCAGCTCAGTCTAAAC TGG Intergenic
No off target data available for this crispr