ID: 1164947625

View in Genome Browser
Species Human (GRCh38)
Location 19:32309789-32309811
Sequence CAGCTCAGTCTAAACTGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947622_1164947625 -9 Left 1164947622 19:32309775-32309797 CCTGTCGCCGGCAGCAGCTCAGT No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947619_1164947625 -2 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947616_1164947625 8 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947618_1164947625 2 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947621_1164947625 -8 Left 1164947621 19:32309774-32309796 CCCTGTCGCCGGCAGCAGCTCAG No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947615_1164947625 23 Left 1164947615 19:32309743-32309765 CCAGGGCGGATACATCCAGAACC No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947620_1164947625 -7 Left 1164947620 19:32309773-32309795 CCCCTGTCGCCGGCAGCAGCTCA No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data
1164947614_1164947625 24 Left 1164947614 19:32309742-32309764 CCCAGGGCGGATACATCCAGAAC No data
Right 1164947625 19:32309789-32309811 CAGCTCAGTCTAAACTGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947625 Original CRISPR CAGCTCAGTCTAAACTGGCC CGG Intergenic