ID: 1164947627

View in Genome Browser
Species Human (GRCh38)
Location 19:32309798-32309820
Sequence CTAAACTGGCCCGGGACCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164947620_1164947627 2 Left 1164947620 19:32309773-32309795 CCCCTGTCGCCGGCAGCAGCTCA No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947616_1164947627 17 Left 1164947616 19:32309758-32309780 CCAGAACCTGCCACTCCCCTGTC No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947623_1164947627 -7 Left 1164947623 19:32309782-32309804 CCGGCAGCAGCTCAGTCTAAACT No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947618_1164947627 11 Left 1164947618 19:32309764-32309786 CCTGCCACTCCCCTGTCGCCGGC No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947621_1164947627 1 Left 1164947621 19:32309774-32309796 CCCTGTCGCCGGCAGCAGCTCAG No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947619_1164947627 7 Left 1164947619 19:32309768-32309790 CCACTCCCCTGTCGCCGGCAGCA No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data
1164947622_1164947627 0 Left 1164947622 19:32309775-32309797 CCTGTCGCCGGCAGCAGCTCAGT No data
Right 1164947627 19:32309798-32309820 CTAAACTGGCCCGGGACCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164947627 Original CRISPR CTAAACTGGCCCGGGACCTC CGG Intergenic
No off target data available for this crispr