ID: 1164952088

View in Genome Browser
Species Human (GRCh38)
Location 19:32345529-32345551
Sequence GGCCCCGCCTACCGGCGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164952088_1164952095 12 Left 1164952088 19:32345529-32345551 CCGGGACGCCGGTAGGCGGGGCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1164952095 19:32345564-32345586 CGCCCCCGCTGCCCGCCATTCGG 0: 1
1: 0
2: 2
3: 9
4: 79
1164952088_1164952096 13 Left 1164952088 19:32345529-32345551 CCGGGACGCCGGTAGGCGGGGCC 0: 1
1: 0
2: 0
3: 11
4: 103
Right 1164952096 19:32345565-32345587 GCCCCCGCTGCCCGCCATTCGGG 0: 1
1: 0
2: 0
3: 17
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164952088 Original CRISPR GGCCCCGCCTACCGGCGTCC CGG (reversed) Intergenic
901506535 1:9689296-9689318 GGCCCCGCCTGGCAGCGTCCTGG + Intronic
902332905 1:15739305-15739327 GGCCCCGCCTACCTGCGCCTGGG + Exonic
902343644 1:15800371-15800393 GGCCCCGCCTCCAGGAATCCAGG - Intergenic
903413774 1:23168103-23168125 GGCCGCGCCGGCCCGCGTCCCGG - Intronic
904464794 1:30701387-30701409 GGCCCCGCCTACCCACTGCCTGG + Intergenic
905387404 1:37614129-37614151 GGCCCCTCCTTCTGGGGTCCTGG + Intronic
912793510 1:112675308-112675330 GGCCCCGGGTTCCGGCCTCCGGG - Intronic
916566423 1:165982848-165982870 GCCCCAGCCTACCAGCCTCCCGG + Intergenic
919705325 1:200669970-200669992 GGCCCCGCCTCCCCGCCGCCCGG - Intergenic
920872561 1:209806199-209806221 GGCCACGCCCCCCGGCGTTCGGG + Intergenic
924775503 1:247112446-247112468 GGCCCCGCCGGCCTGAGTCCTGG + Intergenic
1066022545 10:31318740-31318762 GTCCCCGCCTGCCTGCTTCCTGG - Intronic
1070989177 10:80716268-80716290 GGCCCAGCTTACCTGCATCCTGG + Intergenic
1071932182 10:90484811-90484833 GGCCCAGGCTACCAGCGTCCTGG + Intergenic
1073466707 10:103698437-103698459 GGCCCCGCAGACAGGCATCCTGG - Intronic
1076554435 10:131312222-131312244 GCCCGCGCCTAGCAGCGTCCGGG - Intergenic
1083762653 11:64827069-64827091 GGCCCTGCCAACGGGCGGCCCGG - Exonic
1084171236 11:67401898-67401920 GGCCCCGCCTCCAGGCCTCCCGG + Intronic
1084175429 11:67420165-67420187 GGCCCCTCCTGAAGGCGTCCAGG - Intronic
1088250712 11:107858816-107858838 GGCACCGCCTCCCGTCTTCCGGG - Exonic
1092821428 12:12357068-12357090 GGCACCGCCCATCTGCGTCCCGG + Intronic
1095958424 12:47819442-47819464 GGGCCCGCACACCGGCGGCCGGG + Intronic
1095965258 12:47863189-47863211 GTCCCCTCCTACCTGCCTCCTGG - Intronic
1097057453 12:56258382-56258404 GGCCCCGCCTACCGGGGGGCGGG + Exonic
1098342977 12:69470625-69470647 GGGCTCGGCTGCCGGCGTCCGGG + Intronic
1119003836 14:70907325-70907347 GGCGCCTCCTGCCGACGTCCGGG - Intergenic
1122422134 14:101584260-101584282 GGCCCCGCCCTCCAGCCTCCGGG - Intergenic
1122939039 14:104973071-104973093 GGCCCCACCTACCGGACCCCTGG + Intronic
1124500902 15:30225588-30225610 GGCCCCGCCTCCGGCCCTCCTGG - Intergenic
1124742668 15:32313079-32313101 GGCCCCGCCTCCGGCCCTCCTGG + Intergenic
1125568463 15:40695470-40695492 GTCCTCGCCCACCTGCGTCCTGG + Intronic
1126698047 15:51342037-51342059 GACCCCGCCTACCGGCACCATGG - Exonic
1129516845 15:76162221-76162243 GGCCCCTGCTACCGGCGGCCTGG - Intronic
1132593591 16:737783-737805 TGCCCCGCCCACCGGAGGCCAGG - Intronic
1133021049 16:2967132-2967154 GCGCCCGCCCACCGCCGTCCGGG + Exonic
1136261726 16:29082074-29082096 GGCCCCGCCTTCCGGGGCCGGGG + Intergenic
1138180487 16:54937545-54937567 GGCGCCGCCTACCGGCCCCTGGG + Intergenic
1139520629 16:67480869-67480891 GACCCCCCCTTCCGGCTTCCCGG + Intronic
1141982925 16:87561048-87561070 GGCCCCACCTCCAGGAGTCCTGG - Intergenic
1142412479 16:89923589-89923611 GGCCCCGCGTCCCGGCCGCCCGG - Intronic
1143002164 17:3801225-3801247 GTCCCCGCCTCCTGGCCTCCTGG - Exonic
1143119863 17:4599903-4599925 GGCCCCGCCTCCCGGTGGCCTGG + Intronic
1144495282 17:15741750-15741772 GGCACTGCCTAGCGGCCTCCTGG - Intronic
1145765585 17:27456506-27456528 GGCCGGCTCTACCGGCGTCCCGG + Intergenic
1152362579 17:79839478-79839500 GGCCCCGCCCGCTGACGTCCGGG - Intergenic
1152809840 17:82376184-82376206 GGCCGCACCTACAGGCCTCCTGG + Intergenic
1153281098 18:3415153-3415175 GGCTCTGCCTTCCGGCGACCCGG + Intronic
1153711956 18:7809195-7809217 GCCGCCTCCTACCGGCATCCTGG - Intronic
1159798070 18:72867692-72867714 GGCCCCGGCTCGGGGCGTCCCGG - Exonic
1160514438 18:79470733-79470755 GGCCCCGCCTCCCGTCTTCAGGG + Intronic
1160672602 19:373416-373438 GCCCCCGGCTGCCGGCCTCCAGG - Intronic
1160732567 19:647960-647982 GGCCCGGCCCACCGGCCCCCTGG - Exonic
1160897205 19:1408353-1408375 GCCGCCGCCTCCCGGCTTCCTGG + Intronic
1162022664 19:7874707-7874729 GGCCCAGCCTATCCGCGTCCAGG - Intergenic
1162416903 19:10543881-10543903 GGCCACGCCCACCGTCATCCGGG + Intronic
1163807110 19:19405998-19406020 GGCCCGGCCGACCCGCGGCCCGG + Intronic
1164624211 19:29715551-29715573 GGCCCCGCGCACCTGCCTCCAGG + Intronic
1164952088 19:32345529-32345551 GGCCCCGCCTACCGGCGTCCCGG - Intergenic
1166882976 19:45940282-45940304 GCCCCCGCCTCCCGGAGCCCTGG - Exonic
1166883023 19:45940414-45940436 GGCCGCAGCTTCCGGCGTCCTGG - Exonic
926247815 2:11133559-11133581 GGCCCCGCCGCTCGGCCTCCAGG - Exonic
930034360 2:47076278-47076300 TGCCGCGCCTCCCGGCGGCCTGG + Intronic
932331683 2:70901485-70901507 GGCGCCGCCTTCCCGCGGCCTGG + Intronic
932607707 2:73175951-73175973 GGCCCCGGCTCCCAGCGCCCGGG + Intergenic
946354605 2:219176977-219176999 GGCCCCGCCTTCCGCCGCCGGGG - Intronic
947544355 2:231000687-231000709 GGCCCTGCCTGCCAACGTCCAGG - Intronic
948436119 2:237955782-237955804 GGCTCCGCCTGCAGGGGTCCTGG - Intergenic
948598064 2:239093076-239093098 GGCCTCGCCCAGCGGAGTCCTGG - Intronic
1176415327 21:6471434-6471456 GGCCCAGCCTTCCGGCCACCAGG - Intergenic
1179690827 21:43079767-43079789 GGCCCAGCCTTCCGGCCACCAGG - Intergenic
1180023367 21:45143439-45143461 GGCACCGCCCACAGGCCTCCTGG - Intronic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1183746687 22:39695760-39695782 GGCCCCGTCAAGCTGCGTCCTGG + Intergenic
1184146458 22:42614502-42614524 GCCCCCGCGTTCCGGGGTCCTGG - Intronic
1185398516 22:50604447-50604469 GGCCCCGCCGGCCGGCGACACGG - Exonic
1185422091 22:50740444-50740466 GGCCCAGCCTTCCTGCTTCCAGG + Intronic
953906773 3:46872355-46872377 GGCCCTGCCTTCGGGAGTCCTGG + Intronic
954632865 3:52056486-52056508 GCCCCGGCCTCCCGGCCTCCCGG + Exonic
956290379 3:67654509-67654531 GGCCCCGCTTCCTGGCGGCCGGG - Exonic
961081874 3:124034142-124034164 CGCTCCGGCTACCGGCGTCCCGG + Intergenic
962222394 3:133574293-133574315 GGCCCCGAGTGCCGGCCTCCCGG - Intronic
963737418 3:149035574-149035596 GGCTCCGCCTCCCGGGGTTCAGG - Intronic
968640667 4:1712829-1712851 GGCCGCGCCTTCCGGGTTCCGGG - Intergenic
969693737 4:8723512-8723534 GGCCCTGCCTAGGGGCCTCCTGG - Intergenic
975118647 4:70705400-70705422 GCCCCCGCCTCCCGGCCACCCGG - Intronic
978795795 4:112706162-112706184 GGCCCCGCCTTCCGGGGCCGGGG - Intergenic
984606330 4:181789674-181789696 AGCCCCGCCTACCAACCTCCAGG + Intergenic
985525493 5:399268-399290 GGCCCATCCTGCCGGGGTCCTGG - Intronic
992289945 5:75271120-75271142 GGCCCCCCCTACCTCCCTCCCGG - Intergenic
1001118517 5:168959573-168959595 GGCCCCGCCTCCAGGCTGCCTGG + Intronic
1002989086 6:2221461-2221483 AGCTCCGCCTCCCGGCCTCCCGG + Intronic
1003427728 6:6008745-6008767 GGGCTCGCCTTCCGGTGTCCAGG + Intergenic
1006366921 6:33621422-33621444 GGCCCCGCCGAGCCGCCTCCTGG + Exonic
1006642465 6:35496415-35496437 GGCCCGGCCTCCCAGCGCCCAGG - Intronic
1013856629 6:114581043-114581065 GCCCCAGGCTACCAGCGTCCTGG - Intergenic
1019689825 7:2404156-2404178 GGCCCCGCCGACCGCAGCCCTGG + Intronic
1020418014 7:7968746-7968768 GGCACCGCCTCCCAGCGCCCAGG - Intronic
1023375416 7:39550824-39550846 GGCCCCGCTTAGAGGCGTCTGGG - Intergenic
1026923732 7:74174528-74174550 GCCCCCGCCTCCCGCCGCCCCGG - Intronic
1029620727 7:101688485-101688507 GGCGCCACCTAGCGGCGCCCGGG - Intergenic
1032427402 7:131832869-131832891 GGCCCTGCCTCCTGGTGTCCTGG - Intergenic
1034522593 7:151632235-151632257 GGCCCCTCCTCCCGGCGGCGCGG - Intronic
1035387646 7:158485016-158485038 GGCCCCGGCCGCCAGCGTCCCGG + Intronic
1038150905 8:24941997-24942019 CGCCCCGCCTCCCGGTGGCCTGG + Intergenic
1039893784 8:41701932-41701954 GGCGCCTCCGACCCGCGTCCCGG + Intronic
1049624684 8:143614734-143614756 GGCCCTGCCCACCGGCTCCCCGG + Intronic
1060114446 9:120929129-120929151 GCCACCGCCTACCGGCGGCCAGG + Intronic
1061052139 9:128203307-128203329 GGCTCCCCCTAGCGGCGTCCGGG + Intronic
1061666713 9:132164311-132164333 GCCCCAGCCTCCCGGCCTCCGGG + Intronic
1062341263 9:136094877-136094899 GACCCCGGCTCCGGGCGTCCCGG - Intronic
1062535164 9:137018231-137018253 CGCCGCGCCTACTGGCGGCCTGG - Exonic
1198398979 X:136251437-136251459 CGCCCCGCCCACCGGCAGCCCGG - Exonic
1198651075 X:138864498-138864520 GGCCCAGCCAACCGAAGTCCTGG + Intronic
1199846275 X:151694927-151694949 GGCCCCGCCCCCCGGCGGCACGG + Intergenic
1200119836 X:153785023-153785045 GGCTCAGCCTCCCGGCCTCCCGG + Intronic