ID: 1164954796

View in Genome Browser
Species Human (GRCh38)
Location 19:32373024-32373046
Sequence AAGGTGTTATTTATGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164954796_1164954802 6 Left 1164954796 19:32373024-32373046 CCCTGCTTCATAAATAACACCTT 0: 1
1: 0
2: 3
3: 28
4: 286
Right 1164954802 19:32373053-32373075 GCATCCTGACATGCTGGAAGGGG 0: 1
1: 1
2: 27
3: 149
4: 643
1164954796_1164954800 4 Left 1164954796 19:32373024-32373046 CCCTGCTTCATAAATAACACCTT 0: 1
1: 0
2: 3
3: 28
4: 286
Right 1164954800 19:32373051-32373073 CAGCATCCTGACATGCTGGAAGG 0: 1
1: 0
2: 5
3: 80
4: 493
1164954796_1164954799 0 Left 1164954796 19:32373024-32373046 CCCTGCTTCATAAATAACACCTT 0: 1
1: 0
2: 3
3: 28
4: 286
Right 1164954799 19:32373047-32373069 TTTGCAGCATCCTGACATGCTGG 0: 1
1: 0
2: 4
3: 24
4: 239
1164954796_1164954801 5 Left 1164954796 19:32373024-32373046 CCCTGCTTCATAAATAACACCTT 0: 1
1: 0
2: 3
3: 28
4: 286
Right 1164954801 19:32373052-32373074 AGCATCCTGACATGCTGGAAGGG 0: 1
1: 0
2: 4
3: 60
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164954796 Original CRISPR AAGGTGTTATTTATGAAGCA GGG (reversed) Intronic
901135452 1:6990130-6990152 AGTGTGTTATTTAGGAAGAATGG + Intronic
903125973 1:21248064-21248086 AAGGTGATATTTCTCAGGCATGG + Intronic
904970695 1:34417586-34417608 GAGTTGTTATTTATGAAGCCAGG - Intergenic
907517179 1:55000178-55000200 AAGGTGTTATTTATAGATGAAGG + Intronic
909609760 1:77539751-77539773 AAGCTGTTACTTAGGAACCAAGG - Intronic
909754508 1:79207183-79207205 AAGTAGAAATTTATGAAGCAAGG + Intergenic
910328367 1:86038640-86038662 AATGTGTAATTTCTGAAGCTAGG + Intronic
910617138 1:89210974-89210996 AAACAGTTATTTATGAAACAAGG + Intergenic
911673028 1:100628690-100628712 AATTTGTAATTTATGAAGCCAGG + Intergenic
911779035 1:101852102-101852124 ATGGTGGTATTTATGATGCTGGG - Intronic
912106314 1:106280986-106281008 AAGGTGTCAATTGTAAAGCATGG - Intergenic
914882803 1:151560584-151560606 AAGATGTCATTTATGCAGCTGGG + Intronic
914954952 1:152153520-152153542 AAGGTGTTATTTTTGGAAAATGG + Intergenic
916223714 1:162468927-162468949 AAGGTGTTAATTAGTAAGGAAGG - Intergenic
916431386 1:164732232-164732254 ATGGTCTTATTTTTGAAGTAAGG + Intronic
916620654 1:166492925-166492947 AATGTGTTATATATGCATCATGG + Intergenic
918011645 1:180592474-180592496 AGGTTGTGACTTATGAAGCAGGG + Intergenic
918054958 1:181012981-181013003 AACTTTTTATTTATGAAGAATGG - Intronic
918838900 1:189507764-189507786 AAGGTGTTATTTAAGAATACTGG - Intergenic
919311811 1:195918546-195918568 ACTGTGTAATTTATGAAGCAAGG - Intergenic
919447231 1:197722368-197722390 AGGATGTTATATAAGAAGCAAGG - Intronic
919581377 1:199378848-199378870 AAAGCTTTATTTATGAAGAAAGG - Intergenic
920207375 1:204302396-204302418 AAGGCGTTAATCATGCAGCATGG - Intronic
921656173 1:217740161-217740183 AAGGTCTTATATAAGAAGAAAGG - Intronic
921822328 1:219631319-219631341 GCGGTGTTACTTATGAGGCATGG - Intergenic
922147018 1:222956541-222956563 AAAGATTTATTTATGAAGTATGG + Intronic
922673697 1:227535820-227535842 CAGGTGCTATTCATGAAGAAAGG - Intergenic
924338827 1:243009585-243009607 AAAGTGCTAATGATGAAGCATGG + Intergenic
1063807742 10:9666620-9666642 AAAGTGTAATTTATAAATCAAGG - Intergenic
1064722915 10:18247911-18247933 AAGGTACCATTTATGAAACAGGG - Intronic
1065686110 10:28286455-28286477 AAGCTGTCATTTTAGAAGCAGGG - Intronic
1065926798 10:30441745-30441767 AGGCTATCATTTATGAAGCATGG - Intronic
1066310800 10:34194080-34194102 CAGTGGTTATTTATGAAGCTTGG - Intronic
1067252891 10:44602899-44602921 TAGGTGTTATCTCTGAAGGAAGG - Intergenic
1068391451 10:56402504-56402526 AAGGCACTATTTATGAACCAGGG - Intergenic
1068596631 10:58909078-58909100 AAGGTGTTAGGTAAGAAGGATGG - Intergenic
1068748462 10:60563138-60563160 AAGATGATATTTATAAAGCTTGG - Intronic
1068987515 10:63120945-63120967 AAGTTGTTATCTATAGAGCAGGG + Intergenic
1071106586 10:82104438-82104460 AAGCTGTCATTTAGGAAGCAGGG + Intronic
1072159890 10:92756274-92756296 AAGAGGTTATTTATTAAGAATGG + Intergenic
1073133758 10:101207777-101207799 AAGGTCTCATTTAAGAAGGAGGG - Intergenic
1074543340 10:114384293-114384315 AAGATGCCATTGATGAAGCAAGG - Intronic
1074888979 10:117719683-117719705 AATGAGTTATTAATTAAGCAGGG - Intergenic
1076004579 10:126938702-126938724 AAGGTGCCATTTTGGAAGCAGGG - Intronic
1076282156 10:129257003-129257025 ATGGTTTTATTTATGAAGTTAGG - Intergenic
1077913546 11:6595416-6595438 GAAGTGTTATTGATTAAGCAGGG - Exonic
1078424319 11:11236991-11237013 CAGCTTTTATTTATGAAGCAAGG + Intergenic
1079998117 11:27317982-27318004 AAGGGGTGTTTTATAAAGCAGGG - Intergenic
1082131061 11:48489934-48489956 AAGGTGTAATGCATAAAGCAAGG + Intergenic
1085869479 11:80332491-80332513 AGGGTGTTTTTGATGAAGGAAGG + Intergenic
1087233047 11:95687442-95687464 AAGGTGTTGTTCGTGTAGCAGGG - Intergenic
1088482492 11:110307962-110307984 AAGGTGCTATATCTGAAGCAGGG + Intergenic
1089006969 11:115100327-115100349 ATGGGGTTATCTATGAAGAATGG + Intergenic
1089801175 11:121029212-121029234 AAGGTAATATATAAGAAGCATGG - Intronic
1090738345 11:129632637-129632659 AAGGAGCTGTTTATGAAGCCTGG - Intergenic
1091963601 12:4719973-4719995 AGGGTGTCATCTATGAAGCTGGG + Intronic
1092688685 12:11081854-11081876 AAGCTCTTATTTATAAAGTAAGG - Intronic
1092861318 12:12721969-12721991 AAAGTGTTATTTTTCAAGGAAGG + Exonic
1093154910 12:15671210-15671232 AAGGTTTTATTTATCAGTCAGGG + Intronic
1093438063 12:19160326-19160348 AAGGAGTAATTTATGACCCAAGG - Intronic
1093451192 12:19316702-19316724 AAGGACTTAATTATTAAGCAGGG + Intronic
1093977043 12:25434767-25434789 AAGGTGCTTTTTAGGATGCAGGG - Intronic
1094560265 12:31546244-31546266 AAAATGTTATTTATTAAGCACGG + Intronic
1095671524 12:44866127-44866149 AAGGTGTAATCTATGAGGAATGG + Intronic
1097492841 12:60291688-60291710 ATGGTGTAATTTATAAAGAAAGG - Intergenic
1098808270 12:75049919-75049941 AAGCAGTTATTTAAGAAGAATGG - Intronic
1100264917 12:92966637-92966659 AAGGTGATATTTCTTAAGGATGG + Intergenic
1102576302 12:113858218-113858240 AACCTTTTATTTTTGAAGCAAGG - Intronic
1102798058 12:115706580-115706602 AAGGAGTCATCTCTGAAGCAGGG + Intergenic
1103293177 12:119863913-119863935 AAGGCGCCATTTTTGAAGCAGGG + Intronic
1105422742 13:20267224-20267246 AAGGTTTTATTTAGGAAGCAAGG + Intergenic
1106028842 13:25980085-25980107 AGGGGGTAATTTATCAAGCATGG + Intronic
1106547850 13:30745786-30745808 AAGGTGTCTTTGATGAGGCAAGG + Intronic
1106814456 13:33391811-33391833 AAGGTGTTTCCTCTGAAGCAGGG - Intergenic
1106881526 13:34137067-34137089 AATGTGGAATTTATGAAACATGG + Intergenic
1107676532 13:42803406-42803428 AAAGTGTTATTTATGAAAACAGG - Intergenic
1107980089 13:45727051-45727073 AAGGTGCCATCTGTGAAGCAGGG - Intergenic
1108383569 13:49877526-49877548 AAAATGTTATTTATGAAACAAGG + Intergenic
1108439852 13:50440063-50440085 AAGCTGTTCTTTAAGAAGGAAGG - Intronic
1108647463 13:52444940-52444962 AGTGTGTTATTTATTATGCAAGG - Intronic
1109562608 13:64072756-64072778 AAAATGTTTTTTATAAAGCAAGG + Intergenic
1111528563 13:89506616-89506638 ACCGTGTAATTTATAAAGCAAGG - Intergenic
1111558115 13:89908087-89908109 AAAAGGTTATTTATGAAACAGGG + Intergenic
1111653871 13:91128876-91128898 AATGTTATATTGATGAAGCACGG + Intergenic
1111786745 13:92796497-92796519 AAAGTGTAATTTAAAAAGCAGGG + Intronic
1114766860 14:25382582-25382604 AAGGTGCTGTTTATGAAGAAGGG - Intergenic
1114860788 14:26518415-26518437 AAGGTGTTATTGATAAAAGAGGG - Intronic
1117345551 14:54828202-54828224 AATGTGTTAGATCTGAAGCAGGG + Intergenic
1117523169 14:56571432-56571454 AAGATGTTATTTATTAGGCTGGG + Intronic
1118207094 14:63732644-63732666 AACATGTTAATTATGAAGCATGG - Intergenic
1118913559 14:70081947-70081969 AAGCTGTTATTTATAAGGGAGGG - Intronic
1119683440 14:76610739-76610761 AAGGTTTTATTTATTAAGTCAGG + Intergenic
1120004100 14:79337264-79337286 AAGGAGTTAATTATACAGCAGGG + Intronic
1120134608 14:80851763-80851785 AAGGTGTTTTGTAAGAAACATGG + Intronic
1120394608 14:83953210-83953232 AAGTTGATATCTATGAACCAGGG - Intergenic
1122567561 14:102671661-102671683 AAGCTGTTATTTAAAAAGCAAGG - Intronic
1122571620 14:102706922-102706944 AAGGTGGTATTTGTTAAGTATGG - Intronic
1123787655 15:23688902-23688924 AGGATTATATTTATGAAGCATGG - Intergenic
1124068403 15:26367868-26367890 AAGGTTTTATATATGCAGAAGGG + Intergenic
1124942303 15:34229348-34229370 AAGTTATTATTTTTGAAACAGGG + Intronic
1125596830 15:40892920-40892942 GAAGTGTTATGTATGGAGCAGGG + Intergenic
1126336511 15:47591125-47591147 AAAGTGCCATTTATGAAGCAGGG - Intronic
1127696089 15:61449276-61449298 ATGGTATCATTTATGAAGGAGGG - Intergenic
1128654032 15:69446007-69446029 AGGGTGATATTTATAAAACAAGG + Exonic
1128668458 15:69556176-69556198 AAGATGTTAGTTATGATGTAAGG + Intergenic
1130405980 15:83602426-83602448 AAGGTGTCATCTATGAGGAATGG - Intronic
1131370694 15:91878790-91878812 AAGGTCCTTTTGATGAAGCATGG - Intronic
1138827050 16:60333428-60333450 AAGGTGCTAGCTATGAACCAGGG - Intergenic
1139129501 16:64124250-64124272 AATGTGATAGTTATGAACCAAGG - Intergenic
1140539408 16:75742406-75742428 AAAATGTTATTTATGAAACAAGG + Intronic
1140854938 16:78969630-78969652 AAGGTGCTGTTTATGAACAAGGG + Intronic
1143206697 17:5146374-5146396 ATGGTGGTATTTTTGAAGAAGGG + Intronic
1145112538 17:20176449-20176471 AAGGTATTATTTATGTAGTCAGG + Intronic
1146132089 17:30286794-30286816 AAGGTACAATATATGAAGCAGGG - Exonic
1149635624 17:58166688-58166710 ATGGTATTATTCATGAAGTAAGG + Intergenic
1149873705 17:60207836-60207858 ATGGTGGTATTTTTGAAGAAGGG - Intronic
1150087488 17:62285093-62285115 ATGGTGGTATTTTTGAAGAAGGG - Intergenic
1150745513 17:67813548-67813570 GAGGTGTTCTTTATGAGGCGTGG - Intergenic
1150972362 17:70043367-70043389 AATGTGTTACTGAAGAAGCATGG + Intergenic
1151082513 17:71344996-71345018 AAGCAGTTATTTTTCAAGCATGG + Intergenic
1151661128 17:75518830-75518852 ATGGTGTTCGTAATGAAGCATGG + Intronic
1152045851 17:77935194-77935216 AAGCTGTTATTTCAGAAGCCAGG + Intergenic
1153125922 18:1790259-1790281 AATGTGTTATATATAAACCATGG + Intergenic
1153934104 18:9905318-9905340 AAGGTGTTATTTCAGCAGCCAGG - Intergenic
1154061572 18:11066015-11066037 GAGATGTTATCTATGCAGCAGGG - Intronic
1154305835 18:13230166-13230188 AAGGTGCCATCTATGAAGAATGG + Intronic
1156139894 18:34094942-34094964 AAGATGTCATTTATGAAACCAGG - Intronic
1156228458 18:35131479-35131501 AAGGTGCCATCTATGAAGAATGG - Intronic
1156277139 18:35594201-35594223 GAGGAGTTATTTGTGGAGCAAGG + Intronic
1157768894 18:50327043-50327065 AAGGTGTGGTTCATAAAGCATGG + Intergenic
1158167012 18:54551968-54551990 CAGAGGTTATTTATAAAGCAAGG - Intergenic
1158223246 18:55171207-55171229 AAGAGGTTAATAATGAAGCAGGG + Intergenic
1158946940 18:62455242-62455264 AAGGTTTTATTTAACAAGCTGGG + Intergenic
1159177013 18:64850413-64850435 AAAGTATTGTTTATGAAGCTAGG - Intergenic
1159544607 18:69823671-69823693 AAGGAATTAATTGTGAAGCAGGG + Intronic
1159611236 18:70527618-70527640 AAGCTGTTAGTTATTAATCAAGG + Intergenic
1160219146 18:76959915-76959937 AATGCTTTATTTATAAAGCAAGG + Intronic
1161294484 19:3512845-3512867 GGAGTGTCATTTATGAAGCACGG - Intronic
1162508696 19:11103824-11103846 AAGGAGTTATTTACGCAGGAGGG - Intronic
1163128742 19:15258899-15258921 AAGGAGTTATTTCTGAATAAAGG - Intronic
1164954796 19:32373024-32373046 AAGGTGTTATTTATGAAGCAGGG - Intronic
1166743178 19:45126372-45126394 AAGGTGCTGTTGATGCAGCAGGG + Intronic
1166795317 19:45422251-45422273 AAGGTGTAGTTTCTGAGGCAAGG - Intronic
1168672620 19:58252525-58252547 AAAGGGTTATTTATGAAACAAGG - Intronic
927179564 2:20435068-20435090 AACGTGCTTCTTATGAAGCAGGG - Intergenic
931041633 2:58307107-58307129 AAGGTCTTTCTTAAGAAGCACGG - Intergenic
931099799 2:58984458-58984480 TAAGTGTTATTTATGAATGATGG - Intergenic
934844269 2:97652146-97652168 AAGTTATTATTTTTGAAACAGGG + Intergenic
937171924 2:119880801-119880823 AAGAAGTTATATATGAAGCCAGG + Intronic
937282790 2:120731778-120731800 AAGGTGCTATCTATGAAGCAGGG + Intergenic
937356904 2:121203458-121203480 AATGTGTTATTTCTGGAGCTGGG - Intergenic
937665896 2:124486085-124486107 AATGTGGTATATATGAACCATGG + Intronic
938198886 2:129356835-129356857 AAGATGATATTCATGTAGCAAGG - Intergenic
938773464 2:134520970-134520992 CAGGTGTTCCTTATGAAGCAAGG + Intronic
939361553 2:141178834-141178856 AAGGAGTTATTCAAGAATCAAGG - Intronic
939588223 2:144031437-144031459 AAAGTGTTTTTCATGAAGCCAGG + Intronic
940826020 2:158413751-158413773 AATGTGTAATTTTTAAAGCATGG + Intronic
942788036 2:179723720-179723742 AAGGTTTTATTTTTGAATAAGGG + Intronic
942916876 2:181320462-181320484 AAGGACTTATTTATAAAGCACGG - Intergenic
944636472 2:201680365-201680387 AAGGTGCCATTTATGAGTCACGG - Intronic
945366026 2:208955180-208955202 AAAAGGTTATTTATGAAACAAGG - Intergenic
946846111 2:223860310-223860332 AAAATGTTCTTTATGAACCAGGG + Intronic
947483486 2:230524981-230525003 AAAAGGTTATTTATGAAACAAGG + Intronic
948321685 2:237074887-237074909 AAGGGGTTATAAATAAAGCATGG - Intergenic
1169432165 20:5546423-5546445 AAGGTGTTACTTTTGTAGAATGG - Exonic
1169451653 20:5717117-5717139 AAGGTGCCATCTATGAATCAGGG + Intergenic
1169605556 20:7314806-7314828 AATGTGTTATATATAAACCATGG + Intergenic
1169636541 20:7698395-7698417 AAGGTGTCATCTTGGAAGCAGGG + Intergenic
1170307215 20:14951738-14951760 AAGGGGTTATCTTTTAAGCATGG - Intronic
1170406861 20:16047227-16047249 AAGGTATGATTCATGGAGCAAGG - Intronic
1173712597 20:45173916-45173938 AAGGTGATATATATGAACCAGGG - Intergenic
1174935577 20:54864595-54864617 ACTGTGTGATTTATGAAGAAGGG + Intergenic
1175602146 20:60283275-60283297 AAGGGGTTATTTATTAAAAAAGG + Intergenic
1177296461 21:19182626-19182648 AAGCTGTAATTTACAAAGCAGGG - Intergenic
1177475281 21:21612527-21612549 ACGGAGTTCTTTCTGAAGCATGG + Intergenic
1177878471 21:26664493-26664515 AAAAGGTTATTTATGAAACAAGG - Intergenic
1178041634 21:28646340-28646362 AATCTTTTATGTATGAAGCAGGG - Intergenic
1178931030 21:36819363-36819385 CAGGTGTTCATTATGAAGCGTGG - Intronic
1181484628 22:23222977-23222999 AAGATGCCATCTATGAAGCAGGG - Intronic
1182011644 22:27006224-27006246 CAGGTGTCATTGATGTAGCAAGG + Intergenic
1182817471 22:33178413-33178435 AAGGTGATACTCATGAAGAAAGG + Intronic
1183519896 22:38290954-38290976 AAGGTGTTAACTAGGAAGGATGG + Exonic
949673908 3:6430892-6430914 TAAATGTTATTTATGAAGAATGG + Intergenic
950204360 3:11067173-11067195 AAATGGTTATTTATGAAACAAGG + Intergenic
950906097 3:16539673-16539695 ACCGTGTTCTTTATGATGCATGG + Intergenic
951997291 3:28745231-28745253 TAGGTGTTATTAATGAAGAATGG - Intergenic
952317774 3:32246507-32246529 AGGGTGTTGTTTATAAAGCAGGG - Intronic
953613450 3:44468204-44468226 AAGGTGTAAGTTATGAAGGTGGG - Intronic
953621982 3:44541477-44541499 AAGGTGATAACTATGAAGAAAGG - Intergenic
953802602 3:46037285-46037307 AAAATGTTATTTATGAAACAAGG + Intergenic
954855097 3:53637438-53637460 AAGGTTTTTTTTTTGGAGCAAGG + Intronic
956033339 3:65063115-65063137 TGGGAATTATTTATGAAGCACGG - Intergenic
957589475 3:82176874-82176896 AAGATGTTACTTTTGAAGTATGG + Intergenic
957602727 3:82359089-82359111 AAGGTGTTATCCTGGAAGCAGGG - Intergenic
957650935 3:83003070-83003092 ACTGTGGTAATTATGAAGCACGG - Intergenic
960474302 3:118105181-118105203 ATGGAGTTATGTATGAGGCAGGG + Intergenic
960537782 3:118832269-118832291 AATTTGTTATTTTTGAAACAGGG - Intergenic
961111889 3:124291355-124291377 AAGATGAAATTTGTGAAGCAGGG + Intronic
962766719 3:138571307-138571329 AATGTGCTATTGATGATGCATGG - Exonic
963272745 3:143301906-143301928 GAGGTGTTTTTTATGAAACCAGG + Intronic
964448164 3:156782585-156782607 AAGGTGGTACTTTTGGAGCATGG + Intergenic
965087609 3:164119334-164119356 AACTTGTTTTTTATGAAGTAGGG + Intergenic
967013941 3:185464841-185464863 AAGGTGCCATCTATGAAGAATGG - Intronic
968403823 4:321674-321696 AAAGTGTTCATGATGAAGCATGG - Intergenic
968697212 4:2037249-2037271 ACGGGGTAATTTATGAAGAAAGG - Intronic
969103506 4:4787768-4787790 AACGGGTAATTTATGAAGAAAGG - Intergenic
970917004 4:21347665-21347687 AAGATGTTACATATAAAGCATGG + Intronic
972200506 4:36709103-36709125 GAGGTGTTATTTACGAGGTAAGG - Intergenic
973134281 4:46686866-46686888 CAGGTATTATTTATGAAGACAGG - Intergenic
974947861 4:68549741-68549763 AAATTGTTGTTTATGAAGAATGG - Intronic
976951152 4:90833180-90833202 AAGGTGTCATCTTGGAAGCAGGG - Intronic
977232470 4:94468048-94468070 AAAGTTTTAATTATGAAGTAAGG + Intronic
977621360 4:99141233-99141255 AAGGTGTCATTTGTTAAACATGG + Intronic
978080447 4:104583750-104583772 AAAGTGTTATTTACAAAGTATGG - Intergenic
978279938 4:106999273-106999295 CAGATTTTATTTATGAAGTAGGG - Intronic
978697803 4:111603766-111603788 AAGGAGATATTGAAGAAGCAAGG + Intergenic
979238292 4:118425653-118425675 AAAGTGCTAATGATGAAGCATGG - Intergenic
980029309 4:127808176-127808198 AATGTGTTATTTTAGAATCAAGG + Intronic
980176624 4:129354014-129354036 ATTGTCTTATTTATGAAGTAGGG - Intergenic
980347842 4:131645968-131645990 AAGCTATAATTAATGAAGCATGG + Intergenic
981358177 4:143815768-143815790 AAGGGGTAATATATGAAGAAAGG - Intergenic
981369421 4:143941887-143941909 AAGGGGTAATATATGAAGAAAGG - Intergenic
982363433 4:154549382-154549404 AAGGTGATATTTAAGCAGAAAGG + Intronic
984112408 4:175634563-175634585 AAGGTGTTATGTATAACACATGG + Exonic
985142147 4:186851964-186851986 AGGGTGTTGGTTATGAAGCCTGG - Intergenic
985572460 5:655807-655829 CAGGTGTTATTTATGATTCTGGG + Intronic
985586571 5:741349-741371 TAGATGTTAGTTATGAAGAAGGG + Intronic
985601158 5:833528-833550 TAGATGTTAGTTATGAAGAAGGG + Intronic
988016914 5:25570765-25570787 TAAGTGTTATATATGAAACAAGG + Intergenic
988982053 5:36580518-36580540 AAGGTCTGATTGATGATGCATGG + Intergenic
991115511 5:62950138-62950160 AAGATGTTATTGAGGAAGAAAGG - Intergenic
991119078 5:62990165-62990187 AATGTGATATTTATACAGCATGG + Intergenic
993540079 5:89138342-89138364 AATGTGATATATATGAACCAGGG - Intergenic
993772043 5:91940372-91940394 AAGGTGTTATTTAAGAAAGCTGG - Intergenic
994339965 5:98615098-98615120 TAGGTGTTATTTTTGAAACAAGG - Intergenic
995663533 5:114513421-114513443 AAAGTTTTATTTATCAAGCTGGG - Intergenic
996085967 5:119305704-119305726 AATGTGTCATTTATAAAGCGAGG - Intronic
996192087 5:120557128-120557150 CAGGTGTTGTTTATGAAGAGGGG + Intronic
996491112 5:124098418-124098440 AAGTGGTTATTTCTGAAGAATGG - Intergenic
998814666 5:146001055-146001077 AAGAGGTTATTTATGTAGAAAGG - Intronic
998999426 5:147903752-147903774 AATGTTTTATTTTTGAAACAGGG + Intronic
999089831 5:148926463-148926485 TAGGTGTTACTCATGAAGCTGGG - Intronic
999633071 5:153591708-153591730 ATACTGTTATTTAAGAAGCAAGG + Intronic
1000284539 5:159815746-159815768 AAGGTGCCATTTATGAGGAATGG + Intergenic
1001174836 5:169458615-169458637 ATGGTTTTATTTATGGAGTAGGG + Intergenic
1001325113 5:170718454-170718476 AAGAAGTTATTTTTAAAGCAAGG + Intronic
1002864185 6:1106984-1107006 AAGCTGCCATCTATGAAGCAGGG - Intergenic
1004708040 6:18142686-18142708 AAGGTTTTATGTCTGAAGCATGG - Intronic
1004731386 6:18362626-18362648 ATGGTTTTATTTGGGAAGCAAGG + Intergenic
1004899619 6:20182261-20182283 AAGGTGCCATTTATGAGGAATGG - Intronic
1006493650 6:34405635-34405657 AAGTTGTTATCTATAGAGCAGGG - Intronic
1009525398 6:64738371-64738393 AAGCTTTTACTTATGGAGCAAGG - Intronic
1009774394 6:68186921-68186943 AAGATGTGATTGATGGAGCAAGG + Intergenic
1011584238 6:88907555-88907577 AATGGGTAATTTATGAAGGAAGG - Intronic
1012711647 6:102614716-102614738 AAAGGGTTATTTATGAGACAAGG + Intergenic
1013452445 6:110297882-110297904 AAGTTGTTCTTGAAGAAGCATGG + Intronic
1013554304 6:111240738-111240760 AAGGTGTCATCTTTGAAGCAGGG - Intergenic
1015694181 6:135961728-135961750 CAGTTTTTATTTATGAACCAGGG - Intronic
1016506830 6:144791398-144791420 AATGTGTTTTTGATGAGGCAAGG - Intronic
1016935666 6:149447638-149447660 AATGATTTATTTTTGAAGCATGG + Intronic
1020743001 7:12045812-12045834 ATGCTATTATTTATGAAGGAAGG - Intergenic
1021609819 7:22445981-22446003 TGGGCTTTATTTATGAAGCATGG + Intronic
1021811541 7:24406491-24406513 AAGATGTTATTAATGAAGGCAGG + Intergenic
1022458031 7:30576324-30576346 AAAGAGTTATTTATGAAACAAGG - Intergenic
1023066934 7:36387958-36387980 AATGTGTTACTTATGAACAAAGG - Intronic
1024117464 7:46207488-46207510 AAGGTGTGAACTATGAAGAAGGG - Intergenic
1024912320 7:54459317-54459339 AATGTTTTATTTCTGAAACAGGG + Intergenic
1025025001 7:55509379-55509401 AAGACATCATTTATGAAGCAGGG - Intronic
1027722665 7:81764485-81764507 AACATGTTATTTATTGAGCATGG + Intronic
1028175340 7:87650400-87650422 AAGGTGTCATCTATGAGGAATGG - Intronic
1028397289 7:90384804-90384826 ATGGTTTGATTTGTGAAGCAGGG - Intronic
1030334626 7:108311361-108311383 CAGGTGTTCTTTATGAAACAAGG + Intronic
1031930946 7:127685409-127685431 AAGCTATTTTTTATGAAGCGTGG + Intronic
1032811434 7:135422673-135422695 AAGGTGCTATGTAAGAGGCAAGG + Intronic
1033054388 7:138036120-138036142 AAAAGGTTATTTATGAAACAAGG + Intronic
1034536436 7:151728588-151728610 AAGGGGTAAATAATGAAGCAGGG - Intronic
1038090969 8:24252694-24252716 GAGGTGTAATTTATGGAGAATGG + Intergenic
1039384909 8:37126816-37126838 AAGGTGTTATGCATCAAGCAAGG - Intergenic
1039623955 8:39028355-39028377 AATTTTTTTTTTATGAAGCATGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041181798 8:55256959-55256981 TAGGTGCCATTTATGAAGAATGG - Intronic
1041674061 8:60520385-60520407 AAGCAGTTAATTATCAAGCATGG + Intronic
1041871162 8:62635677-62635699 AAGGTGCTGTCTATGAACCAGGG + Intronic
1041970866 8:63740957-63740979 TAGGTGATATTTATTAACCAGGG - Intergenic
1042701228 8:71617185-71617207 AAAGTGTTTTTTATCATGCAGGG - Intergenic
1042990904 8:74638648-74638670 CAGGTATTATTTATTAAGCTGGG + Intronic
1043011641 8:74888472-74888494 AAGGTGTCATCTATGAACCTTGG - Intergenic
1043341124 8:79240952-79240974 ATGGTGTTATTTATGAAAATGGG + Intergenic
1044012077 8:87006526-87006548 AAGCTTTTATTTATGAAGGAAGG + Intronic
1044013825 8:87026739-87026761 AAAAGGTTATTTATGAAACAAGG - Intronic
1044862784 8:96539829-96539851 AAGGTGTCATTTCTGGAGCAAGG + Intronic
1046220886 8:111212870-111212892 AATGTGTTATTCATGACCCAAGG - Intergenic
1046456971 8:114478629-114478651 AAGGTGAGATTTTTGGAGCAAGG + Intergenic
1046526192 8:115384978-115385000 AAGGTGTTATGACTGAAGCAAGG + Intergenic
1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG + Intergenic
1049264121 8:141657759-141657781 AAGGTGTGGGTTATGAAGCCTGG + Intergenic
1049456357 8:142692893-142692915 AAATAGTTACTTATGAAGCAAGG - Intergenic
1050854819 9:10339914-10339936 AAGGTGTTATTTCAGAAGGTTGG - Intronic
1051225187 9:14891798-14891820 TAGGTGTTATGTCAGAAGCAAGG + Intronic
1056183482 9:84108367-84108389 AAGGTGTTTTCAATGGAGCAGGG - Intergenic
1056244305 9:84679066-84679088 AAGGTGCCATTTATGAGGAATGG + Intronic
1056854286 9:90111920-90111942 AAGATGTTACTCATGAAACAAGG - Intergenic
1057013139 9:91625323-91625345 TAAGTGTGATTTATAAAGCAAGG - Intronic
1058753785 9:108065296-108065318 AAGGTGTTAAATATGTAGGATGG - Intergenic
1060652382 9:125339657-125339679 ATGGTCTTATTTATGGAGAAAGG - Intronic
1061266673 9:129509802-129509824 AAGGTGCCATGTTTGAAGCAGGG - Intergenic
1061895556 9:133645256-133645278 AAGGTATTACTTATGCAGCCAGG - Intronic
1203733290 Un_GL000216v2:110962-110984 AATGTGGTATATATGTAGCATGG + Intergenic
1191908203 X:66118627-66118649 AAGGTATTATTTCTCAAGAAAGG - Intergenic
1194008913 X:88534225-88534247 AAAGTGTTATTTATGAAACATGG - Intergenic
1195758987 X:108225970-108225992 CAAATGGTATTTATGAAGCAGGG + Intronic
1197003508 X:121468891-121468913 AAGCTTTTAGTTATGAAGGAAGG + Intergenic
1198718724 X:139591982-139592004 AATGTGTTATTTAAGAATCTGGG - Intronic
1198842916 X:140878414-140878436 AAGGTTTAATTTTTGAATCAAGG + Intergenic
1198891788 X:141404574-141404596 AAGGTGTTGTCTTGGAAGCAGGG - Intergenic
1199540290 X:148951271-148951293 AAGGTGATACACATGAAGCAGGG - Intronic
1199789236 X:151135961-151135983 AAAAGGTTATTTATGAAACAAGG - Intergenic
1202627718 Y:56877463-56877485 AATGTGGTATATATGTAGCATGG - Intergenic