ID: 1164961384

View in Genome Browser
Species Human (GRCh38)
Location 19:32433841-32433863
Sequence GTGATTAATTACCCTTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164961384_1164961385 -5 Left 1164961384 19:32433841-32433863 CCATAATAAGGGTAATTAATCAC 0: 1
1: 0
2: 1
3: 7
4: 116
Right 1164961385 19:32433859-32433881 ATCACCAGCCCTTCGCTTAGTGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164961384 Original CRISPR GTGATTAATTACCCTTATTA TGG (reversed) Intronic
907694623 1:56710534-56710556 ATTATTAACTACCCTAATTATGG - Exonic
907810720 1:57867164-57867186 GTGATTAATGACCGTGGTTATGG - Intronic
908495969 1:64695288-64695310 GTATTTAATTTCCCTTGTTAGGG - Intergenic
912367319 1:109145123-109145145 GGGATTAGGTACCCTTATAAAGG + Intronic
916061840 1:161104380-161104402 GTGGTTAATCATCTTTATTAGGG - Intronic
923894561 1:238254992-238255014 CTGTTGAATTACCTTTATTATGG + Intergenic
1071982585 10:91018770-91018792 GTGATAAAGTACCATTTTTATGG + Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078235872 11:9484148-9484170 ATGATTAATTACCGTATTTAAGG + Intronic
1079754819 11:24244126-24244148 GTCATTAATTAACCTTATTATGG - Intergenic
1080633391 11:34101973-34101995 GTTATTGATTACCTTGATTAGGG + Intergenic
1080819059 11:35787909-35787931 GTAATGAATTACCCTGTTTATGG + Intronic
1085913255 11:80853691-80853713 CTGATTAATTACTTTTATTTTGG - Intergenic
1090093556 11:123722372-123722394 GTGATTACTAACCTTTATTGTGG - Intergenic
1090762394 11:129848890-129848912 GGGATTAAGCACCCTTATAAAGG - Intronic
1091536058 12:1410752-1410774 TTTATTAATTACCCTTTCTAGGG + Intronic
1093179353 12:15949909-15949931 GTGAGTTATTACCCTCATTTTGG + Intronic
1094272211 12:28629531-28629553 GTGATTCATTAAACTTATTTTGG - Intergenic
1096934321 12:55254879-55254901 ATTATAAATTACCCTTCTTAAGG + Intergenic
1097534838 12:60855406-60855428 TTGATTCATTGCCCTTTTTATGG - Intergenic
1106372689 13:29151892-29151914 GTGGTTAATTACCTTTTTGATGG + Intronic
1115693861 14:35875694-35875716 ATGGTTAATTGCACTTATTAAGG + Intronic
1121028625 14:90637638-90637660 GTGATAAATTAGCTTTTTTATGG - Intronic
1126974914 15:54166020-54166042 GTGATAAATTATCTTTATTAAGG + Intronic
1138121393 16:54403439-54403461 GTGATAAATTCCCCCTTTTAAGG + Intergenic
1141325565 16:83055364-83055386 TTTCTTAATTACCCTTACTAGGG - Intronic
1155177854 18:23316495-23316517 GTTAATAATTACCCTGATTGTGG - Intronic
1158062505 18:53362900-53362922 GTTATTCATTACCATTATTATGG - Intronic
1164961384 19:32433841-32433863 GTGATTAATTACCCTTATTATGG - Intronic
924995298 2:355461-355483 GTGATTAATTATCCTTCTGTGGG - Intergenic
931115400 2:59161360-59161382 GGGATTAAGTACCCTCATAAAGG - Intergenic
931514436 2:63037601-63037623 CTGATTCATTCTCCTTATTAAGG - Exonic
931933817 2:67172340-67172362 ATTATTAATTACAATTATTATGG - Intergenic
932021378 2:68090864-68090886 GAGATTAAAAACCCGTATTAGGG + Intronic
933985957 2:87592309-87592331 GTGATAACTTACTCTTACTATGG - Intergenic
936307880 2:111358495-111358517 GTGATAACTTACTCTTACTATGG + Intergenic
938045961 2:128120586-128120608 GTGATTAATTACGATTAATCAGG + Intronic
938735497 2:134182671-134182693 GTGATTAAGTACGCTTGTGATGG - Intronic
939150728 2:138469438-138469460 GTGATTCATGATTCTTATTAAGG + Intergenic
939341415 2:140900055-140900077 GTCATCTATGACCCTTATTATGG + Intronic
940637281 2:156313775-156313797 ATTATTAATAACCCTTATAATGG - Intergenic
940657127 2:156501356-156501378 GTGATTAAGGACACATATTATGG + Intronic
940701264 2:157046074-157046096 GTTAGTAATTATCATTATTATGG + Intergenic
941235990 2:162974707-162974729 ATGATTAATTTACCTGATTAAGG + Intergenic
1170108255 20:12775966-12775988 GTGATTATTTGACATTATTAAGG - Intergenic
1170488603 20:16846554-16846576 GTGATTAAGGACCATTATTCGGG + Intergenic
1170690490 20:18611034-18611056 ATGATTTTTTACTCTTATTAGGG - Intronic
1177194209 21:17885529-17885551 GTGATTAATTAGCCTTTAGATGG + Intergenic
949632865 3:5947938-5947960 CTTATTAAATACACTTATTAGGG - Intergenic
951046785 3:18048511-18048533 GGGAATAATAACACTTATTAAGG + Intronic
957324370 3:78673683-78673705 CTGATTATATACCCTTATTTTGG - Intronic
958793436 3:98680979-98681001 GAGATTAATCACCTTTTTTATGG - Intergenic
960178441 3:114545610-114545632 ATGATTAATAACCCATAGTAGGG + Intronic
960190641 3:114701017-114701039 TTGATTAACTACCCTTTGTAGGG - Intronic
960373448 3:116869538-116869560 GTGATTGATTCCCCTTTGTAAGG + Intronic
962665512 3:137650220-137650242 GTGATAAATTTCTTTTATTAGGG + Intergenic
963653189 3:148010838-148010860 GTGATTAATTATTTTTATGAGGG + Intergenic
965138704 3:164807701-164807723 GTGATGAAGTAGCCTTAATAGGG - Intergenic
967255746 3:187590145-187590167 TTGAGCCATTACCCTTATTAGGG + Intergenic
971641678 4:29141860-29141882 ATGATTAATTAGCCTTCTAATGG + Intergenic
971737292 4:30470871-30470893 TTAATTAAATACCCTTATAATGG - Intergenic
973748005 4:53983626-53983648 GTAATTAATGACTATTATTAGGG - Intronic
974552739 4:63399915-63399937 ATTATTTATTACCATTATTAAGG + Intergenic
974993410 4:69122998-69123020 CTGATTAATTAGCTTTTTTATGG - Intronic
976439703 4:85059035-85059057 GTGAATATTTACATTTATTATGG - Intergenic
979024441 4:115551044-115551066 GGTAATAATTACTCTTATTAAGG - Intergenic
983445784 4:167850013-167850035 GTGGCTCATTACCCTAATTAAGG - Intergenic
989020540 5:37000560-37000582 CTGATGAATTACCCTCACTAAGG - Exonic
991689812 5:69215072-69215094 GTTATAAATTACCCATACTAAGG + Intergenic
994341243 5:98631079-98631101 GTGGTTAATCAACCTCATTAAGG + Intergenic
996670373 5:126111083-126111105 GTGAATAAATAACCTTATTCTGG - Intergenic
997635715 5:135403655-135403677 GTGAGTAGTTACCCTTAATGAGG + Intergenic
998253798 5:140569896-140569918 GTTATTAATTATCCATAATAAGG + Intronic
998677052 5:144421308-144421330 GTGATTTATGACCTATATTAAGG + Intronic
1000122653 5:158212031-158212053 GTGATTTATGACTCTTATTTTGG - Intergenic
1000376794 5:160590126-160590148 GTGATTAACTCCTCTTATTCTGG - Intronic
1002845716 6:942681-942703 GTGGTTAAATGCCCTTCTTAGGG - Intergenic
1003851541 6:10228266-10228288 TTGATTAATTGCCTTTAATAAGG - Intergenic
1007006887 6:38372593-38372615 GTGTTTACTTTCCCTTTTTAGGG + Intronic
1007405852 6:41635912-41635934 GTGATTAATTACCTTAATCCTGG + Intergenic
1008797887 6:55327122-55327144 TTGTTTAATTAGCCTCATTAAGG - Intergenic
1009636630 6:66274164-66274186 GTGATTAATTAGCTTGATTGTGG + Intergenic
1011302175 6:85887863-85887885 GTGGTTAAAAACCCTTATTTTGG + Intergenic
1011609867 6:89140431-89140453 GTTAATAATTACCTTTACTAAGG - Intergenic
1011930725 6:92708717-92708739 GTGATGTCTTACCCTTTTTAGGG - Intergenic
1012061217 6:94484722-94484744 TTGATAAATTGCCCTAATTATGG + Intergenic
1012570435 6:100719303-100719325 GTGATTATTTCCCCTTATTTAGG - Intronic
1012920160 6:105213531-105213553 GTGATTTATCACCACTATTATGG - Intergenic
1013285646 6:108679202-108679224 GTAATTACTTACTCTTTTTATGG + Intronic
1013622157 6:111900265-111900287 GTGATTACTGACATTTATTAAGG + Intergenic
1014925131 6:127261376-127261398 GTGATAATTTACCCGTTTTATGG + Intergenic
1018562394 6:165115502-165115524 GTGATTTATTAAACATATTATGG - Intergenic
1019111607 6:169721602-169721624 TAGATTGATGACCCTTATTAGGG - Intronic
1021854944 7:24845982-24846004 ATAATTAATTACCATTATTTTGG - Intronic
1022226226 7:28366603-28366625 GTGATAAATTACTCTGATTTTGG - Intronic
1024980465 7:55153672-55153694 ATGTTTAATTTCCCTTATAAAGG - Intronic
1028588326 7:92472630-92472652 GTCATTAAATACACTAATTAAGG - Intronic
1030921004 7:115387302-115387324 CTGAATAATGACCCTCATTATGG + Intergenic
1032867256 7:135938953-135938975 GTTATTTTTTACCCTTATAAAGG + Intronic
1036524006 8:9518450-9518472 ATGAATAATGACCCTAATTAGGG - Intergenic
1039018335 8:33178286-33178308 GTGATTAAATATCCTCATTTAGG - Intergenic
1039334022 8:36570314-36570336 AGGATTAATTACCATTTTTATGG + Intergenic
1040627548 8:49167939-49167961 GTGACTAATTACCAATACTAAGG + Intergenic
1040773113 8:51003305-51003327 CTTATTAATTTCCCTTATAATGG - Intergenic
1044346458 8:91110153-91110175 GTGAATATTTACTCTTCTTAAGG + Intronic
1044672005 8:94691706-94691728 GTGTTTAATTACCCTTGAAATGG + Intronic
1045480784 8:102590575-102590597 GAGATTAACTACCCTTAATCTGG - Intergenic
1045600465 8:103709310-103709332 TTGATTGATTACTCTCATTACGG + Intronic
1047670768 8:127143643-127143665 TTGATTCATCACCCTTAGTATGG - Intergenic
1051632743 9:19155460-19155482 TGGATTAATTATCCTTATTAAGG - Intergenic
1053314374 9:37038831-37038853 TTTATTACTTACACTTATTATGG - Intergenic
1053541360 9:38977186-38977208 GTGATTATTCACTCTTATTAAGG + Intergenic
1053805780 9:41800229-41800251 GTGATTATTCACTCTTATTAAGG + Intergenic
1054624778 9:67386722-67386744 GTGATTATTCACTCTTATTAAGG - Intergenic
1057640317 9:96813583-96813605 GTAGGTAATTACCATTATTATGG + Intergenic
1057939360 9:99267450-99267472 GTGTTTATTGACCCTTTTTAAGG - Intergenic
1058336501 9:103836280-103836302 GCAATAAATTACCTTTATTAGGG + Intergenic
1058904567 9:109471482-109471504 GTTATGAAATGCCCTTATTAGGG - Intronic
1061297219 9:129683207-129683229 ATGATTAATTACTGTTATGAAGG - Intronic
1202630796 M:14772-14794 GTGGTTAATTAATTTTATTAGGG - Intergenic
1186339225 X:8625659-8625681 GTGATCAATTACTGATATTATGG + Intronic
1189981037 X:46511233-46511255 GTGAATAATTATCTTTATAAAGG - Intronic
1193256646 X:79356271-79356293 GTGATTAATTATAATTATCAAGG + Intergenic
1193713572 X:84908306-84908328 ATTATTTATTACCCTTCTTAAGG + Intergenic
1194980191 X:100432655-100432677 GTGGATAATTACTCTTTTTATGG - Intergenic