ID: 1164961605

View in Genome Browser
Species Human (GRCh38)
Location 19:32435811-32435833
Sequence ACAGAGATCCACAGCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164961605_1164961610 30 Left 1164961605 19:32435811-32435833 CCTCTGTGGCTGTGGATCTCTGT 0: 1
1: 0
2: 5
3: 39
4: 345
Right 1164961610 19:32435864-32435886 TCATGACATGTCTGCTGTGAGGG 0: 1
1: 0
2: 1
3: 13
4: 172
1164961605_1164961609 29 Left 1164961605 19:32435811-32435833 CCTCTGTGGCTGTGGATCTCTGT 0: 1
1: 0
2: 5
3: 39
4: 345
Right 1164961609 19:32435863-32435885 CTCATGACATGTCTGCTGTGAGG 0: 1
1: 0
2: 2
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164961605 Original CRISPR ACAGAGATCCACAGCCACAG AGG (reversed) Intronic
900795217 1:4703724-4703746 ACACAGAACCCCAGTCACAGAGG + Intronic
903029662 1:20453957-20453979 ACACAGATACACAGACACACTGG - Intergenic
903438814 1:23371718-23371740 ACAGTGCTCCACAGGCACAGTGG - Exonic
903495035 1:23760182-23760204 ACAGGAATGCACAGCAACAGTGG - Exonic
903798141 1:25945879-25945901 ACAGAGATCCAGAGGCGCCGAGG + Intergenic
904393023 1:30198162-30198184 ACAGAGATACAGAGACAGAGGGG + Intergenic
904442764 1:30542430-30542452 ACAAAGTTCCAGAGGCACAGAGG - Intergenic
904879381 1:33683834-33683856 ACAGAGAAGCACACACACAGTGG - Intronic
905106089 1:35564426-35564448 GCAGACACCCACAGCCAAAGAGG - Intronic
906725045 1:48038258-48038280 TCACAGTTCCACAGCCAAAGGGG + Intergenic
906749758 1:48248355-48248377 ACAGAGAAGCACAGGCACAGTGG - Exonic
906778327 1:48549871-48549893 GCAGAGAAGCACAGCCGCAGAGG + Intronic
907804222 1:57802404-57802426 ACAGAGATCAACACCTAAAGGGG + Intronic
909612341 1:77565462-77565484 ACAGTGATCTAGAGCCACAACGG + Exonic
912193342 1:107367525-107367547 ACAGGGATCCACAGGCATAAAGG - Intronic
912808749 1:112777392-112777414 ACAGAGACACAGAGACACAGAGG - Intergenic
913220180 1:116653807-116653829 AGAGGGATGCCCAGCCACAGAGG + Intronic
913538556 1:119797336-119797358 TCAGAGATAAACAGCCATAGAGG - Intronic
915146938 1:153800897-153800919 CCAGAGAACCACAGGCCCAGAGG - Intergenic
915364702 1:155308597-155308619 ACAGGCAGCCAAAGCCACAGCGG + Intergenic
916737790 1:167623372-167623394 ACAGAGATCCACAGACAAGCTGG - Intergenic
917839563 1:178966670-178966692 ACTAAGATCCACAGCCATAATGG + Intergenic
918205984 1:182309884-182309906 ACATGTATCCACAGCCACACTGG - Intergenic
920089050 1:203439477-203439499 TCAGAAATCCACACCCACAAAGG + Intergenic
920989077 1:210918707-210918729 AAACAAATCCACAGACACAGAGG - Intronic
921326584 1:213990276-213990298 ACAGACACACACAGACACAGAGG - Intronic
921527379 1:216234543-216234565 ACAAAGAATCACAACCACAGTGG - Intronic
924322686 1:242865498-242865520 CCAGGGATGCACAGACACAGAGG + Intergenic
1064001918 10:11670711-11670733 ACAGGGATCCATACCCCCAGTGG - Intergenic
1067692475 10:48510757-48510779 ACAGGGATCCCCAGACTCAGGGG + Intronic
1067768227 10:49105078-49105100 ACAGAGAGAGACAGACACAGAGG + Intronic
1068556830 10:58467571-58467593 GCAGAGATCCTCTCCCACAGAGG + Intergenic
1069134570 10:64747784-64747806 ACAGACAGCCAGAGCAACAGTGG - Intergenic
1071517316 10:86306727-86306749 ACAGAGATCCAAAGTCCCTGAGG + Intronic
1072438492 10:95434449-95434471 ACAGACATTCACATACACAGAGG + Intronic
1072881255 10:99232277-99232299 ACACAGATACACAAACACAGCGG + Intronic
1073135899 10:101220229-101220251 ACAGTGACCCACAGACACACAGG - Intergenic
1073338798 10:102729760-102729782 ACAGTTAGCCGCAGCCACAGCGG - Exonic
1073462434 10:103673824-103673846 AAAGAGAACCACAGGCTCAGGGG + Intronic
1073954942 10:108859473-108859495 AGAGAGATTTACAGCAACAGAGG - Intergenic
1074338145 10:112599132-112599154 ACAGAGGTCCAGGGCCACTGTGG + Intronic
1075245020 10:120813412-120813434 ACAGAGACTCAAAGCTACAGGGG - Intergenic
1075247653 10:120838025-120838047 TCAGAGATCCAAAGAAACAGTGG + Intergenic
1076577342 10:131478473-131478495 ACACAGATCCAGAGCCAGAAGGG - Intergenic
1076765796 10:132632341-132632363 CCAGAGAGATACAGCCACAGGGG - Intronic
1076883393 10:133250490-133250512 ACAGAGATAGAGAGACACAGTGG + Intergenic
1078661696 11:13292679-13292701 AAAGAGACCCACAGGCACAATGG + Intronic
1080761181 11:35250398-35250420 ACAGAGACCCACAGAAAGAGTGG - Intergenic
1080953728 11:37067479-37067501 AAAGAGGCTCACAGCCACAGTGG + Intergenic
1081616798 11:44596118-44596140 GCAGAGGGCCAGAGCCACAGTGG - Intronic
1081711146 11:45216324-45216346 AAAGAGCTGCTCAGCCACAGTGG + Intronic
1083581010 11:63825390-63825412 ACAGGGGACCACAGACACAGAGG - Intronic
1083703906 11:64500020-64500042 CCAGAGACCAACAGCCTCAGGGG - Intergenic
1083981225 11:66172267-66172289 ACAGAGAGCCACAGTCATAAGGG - Intronic
1084966202 11:72745990-72746012 ACAGAGATCAAGAGCCTGAGGGG - Intronic
1087465545 11:98500095-98500117 ACAGGGAGCCACAGCCACAAGGG + Intergenic
1088763957 11:112958926-112958948 ACAGAGATCAACAACCACACGGG + Intergenic
1089601622 11:119619185-119619207 GCAGAGATCTACAGGAACAGAGG + Intergenic
1090236944 11:125155584-125155606 ACATAGATACACAGCCACATTGG - Intergenic
1091312349 11:134583672-134583694 ACAGAGGTGCCCAGGCACAGAGG + Intergenic
1091664938 12:2412111-2412133 AGGGACCTCCACAGCCACAGGGG - Intronic
1091856922 12:3747860-3747882 ACAGAGCTCCACAGGCTCAGGGG + Intronic
1091856931 12:3747898-3747920 ACAGAGTTCCACAGGCTCAGGGG + Intronic
1091856940 12:3747936-3747958 ACAGAGCTCCACAGGCTCAGGGG + Intronic
1091856949 12:3747974-3747996 ACAGAGTTCCACAGGCTCAGGGG + Intronic
1091856958 12:3748012-3748034 ACAGAGTTCCACAGGCTCAGGGG + Intronic
1091856967 12:3748050-3748072 ACAGAGTTCCACAGGCTCAGGGG + Intronic
1092236843 12:6815805-6815827 ACAGAGCAGCCCAGCCACAGGGG - Intronic
1092253876 12:6915885-6915907 ATAGAGATCCACCTCCACTGTGG - Exonic
1092880748 12:12886067-12886089 AGAGAGATACAGAGACACAGAGG - Intergenic
1093844363 12:23950645-23950667 AAAGAGATCCACAGCCAGGGGGG - Intronic
1097190099 12:57215663-57215685 ACAGAGGAGCACAGCAACAGAGG - Intergenic
1097258553 12:57699247-57699269 CCAGAGATCCACAGCCCCCTTGG - Intronic
1097541323 12:60947336-60947358 ACTGTGATCCAAAGTCACAGTGG + Intergenic
1098595612 12:72271516-72271538 CCAGACACCCACAGCCACAGAGG - Intronic
1099855276 12:88156616-88156638 GCAGAAATCCACAGCTACAATGG - Intronic
1099874734 12:88390779-88390801 ACAGAGATTCACAGAGAGAGTGG - Intergenic
1100128269 12:91457138-91457160 GCAGAGATACCCAGCAACAGAGG - Intergenic
1100133877 12:91530083-91530105 ACAGAGACACACACACACAGAGG + Intergenic
1100196163 12:92247920-92247942 AGAGAGATCCCCAACCAGAGTGG + Intergenic
1100680359 12:96913075-96913097 ACAGAGATCCTCTCCCACTGAGG - Intronic
1101311465 12:103584419-103584441 ACAGAATCCTACAGCCACAGAGG + Intergenic
1101366500 12:104076359-104076381 ACACAGATCCACAATCACAGTGG - Intronic
1102543529 12:113638585-113638607 TCAGAGATCCGAAGGCACAGGGG - Intergenic
1104672398 12:130689696-130689718 ACAGAGATACACAGAACCAGTGG + Intronic
1104963292 12:132498192-132498214 AGAGAGACCCACACCCACACAGG - Intronic
1104985947 12:132597553-132597575 ACAGAGATACACAGAGACAGAGG - Intergenic
1105037963 12:132940226-132940248 TAAGGGATGCACAGCCACAGAGG + Intronic
1105935190 13:25091861-25091883 ACAGAGCTCCACAGCCACCAAGG + Intergenic
1106312929 13:28569381-28569403 ACAGAGACCCACAGCCTGATAGG - Intergenic
1106763561 13:32891747-32891769 ACATAGGTCCACAGCCCCACTGG + Intergenic
1107207509 13:37811371-37811393 ACAGTGATCCTGAGCAACAGAGG + Intronic
1107610945 13:42112446-42112468 ACAGAGTTCCAAAGCCACGTGGG - Intronic
1108343739 13:49523541-49523563 ACAGAGAACTACAGTTACAGGGG - Intronic
1108736911 13:53293692-53293714 GCAGAGATCCTCAGCCCAAGGGG - Intergenic
1110404564 13:75135411-75135433 ACAGAGAATCATAACCACAGTGG + Intergenic
1112188257 13:97149069-97149091 ATAAACAGCCACAGCCACAGTGG - Intergenic
1112473369 13:99709346-99709368 ACAGAGAACCACAGACTGAGTGG - Intronic
1112680678 13:101761463-101761485 ACAGAGACCCACAGTCACGTGGG - Intronic
1113138711 13:107122752-107122774 ACAGAGCCCCATGGCCACAGAGG - Intergenic
1113457879 13:110461901-110461923 CCAGTGCTCCACAGCCACTGTGG + Intronic
1113659354 13:112095029-112095051 ACAGAGAGACAGAGACACAGAGG - Intergenic
1113722228 13:112567928-112567950 ACTGAGACCCACAGCCAAATGGG + Intronic
1113821328 13:113215606-113215628 AGAGATCTCCACAGCCACACGGG - Intronic
1113821413 13:113216179-113216201 AGAGACCTCCACAGCCACATGGG - Intronic
1115112857 14:29844836-29844858 ACAAAGCTCCACAGCCATATTGG - Intronic
1115620979 14:35139969-35139991 ACAGAGATACACACACACAAAGG - Intronic
1115641362 14:35337573-35337595 ACAGAGACCCACAGTCAAGGTGG + Intergenic
1118065757 14:62188614-62188636 AGAGAGATCCACAAACACAGAGG - Intergenic
1118281270 14:64430931-64430953 ACTGGGATCAACAGCCACACTGG - Intronic
1118705590 14:68477477-68477499 CCAGAGATCCAGAAACACAGCGG - Intronic
1122298083 14:100716747-100716769 ACAGAGATCCACACTCAGTGGGG - Intergenic
1122762325 14:104038420-104038442 ACATAGTTCCTCACCCACAGAGG - Intronic
1123698896 15:22900201-22900223 ACAGAGACACACAGGGACAGTGG + Intronic
1123904669 15:24909858-24909880 ACAGAGACCAGCAGGCACAGCGG + Intronic
1124202600 15:27691196-27691218 ACAGAGAAGGTCAGCCACAGAGG - Intergenic
1125070388 15:35546704-35546726 ACCAAGAGCCAAAGCCACAGAGG - Intergenic
1129023873 15:72550353-72550375 ACAGAGATCAACGGTCACAATGG - Intronic
1130681299 15:85999214-85999236 TCAGATATGCCCAGCCACAGGGG + Intergenic
1130930504 15:88423474-88423496 TCAGAGATACACAAGCACAGAGG + Intergenic
1131029153 15:89171801-89171823 GCAGTGCGCCACAGCCACAGTGG + Intronic
1131305979 15:91243550-91243572 AGACATATCCACAGCCACAGTGG - Intronic
1131581324 15:93646543-93646565 ACAGAGTACCACAGCCTGAGTGG + Intergenic
1131600736 15:93846328-93846350 ACAGGGAAGCACAGCCGCAGTGG + Intergenic
1131872637 15:96777728-96777750 GCAGAGAGCCACAGCCACAGGGG - Intergenic
1132221593 15:100109271-100109293 AAAAAGACCCACAGCCACAGGGG + Intronic
1132726322 16:1340119-1340141 ACACAGATGCACAGGCACACAGG + Intronic
1133320179 16:4908966-4908988 AAAGAAATCCACCACCACAGGGG + Intronic
1133689827 16:8202595-8202617 ACAGAGACACACATACACAGAGG - Intergenic
1133867217 16:9655461-9655483 ACTGAGATCCAGAGCCACAAAGG + Intergenic
1135187349 16:20326833-20326855 ACAGAAATCTACATCCATAGAGG - Intronic
1136284775 16:29234259-29234281 ACAGAGATACACACACACACAGG - Intergenic
1136776809 16:32876246-32876268 AGGGAGATCCACAGAGACAGAGG - Intergenic
1136893808 16:33985267-33985289 AGGGAGATCCACAGAGACAGAGG + Intergenic
1137297408 16:47108521-47108543 ACAGAAATACACAGCCTCAATGG + Intronic
1138090933 16:54174152-54174174 ACAGAAATCAACAGTCACAAGGG - Intergenic
1138552756 16:57756439-57756461 GCTGATATCCACACCCACAGAGG - Exonic
1140239188 16:73185778-73185800 CCCTAGATCCCCAGCCACAGGGG + Intergenic
1141401521 16:83751305-83751327 ACAAAGATACACAGGCACAGTGG + Intronic
1141495486 16:84406778-84406800 AAAGAGATCTCCAGCCGCAGAGG - Intronic
1141914565 16:87086279-87086301 ACGGATATCCACAGCCTCTGTGG - Intronic
1203079225 16_KI270728v1_random:1138355-1138377 AGGGAGATCCACAGAGACAGAGG - Intergenic
1142690174 17:1601413-1601435 ACAGAGCCCCACAGCCAGAGAGG + Intronic
1143362065 17:6379980-6380002 ATAGACATACACAGACACAGAGG - Intergenic
1143515314 17:7416822-7416844 ACAGAGATGCAGAGAGACAGGGG - Intronic
1143529733 17:7495870-7495892 CCAGAGCTCCCCAGCCACAAAGG + Intronic
1144754878 17:17673348-17673370 ACAGAGATCCACAATAACACCGG + Intergenic
1145903782 17:28505594-28505616 ACACAGAGACACAGACACAGGGG + Intronic
1146944335 17:36863781-36863803 ACAGAAAACCACAGCCACAGAGG + Intergenic
1147210020 17:38867626-38867648 CCAGAGAGCCACCGCCAGAGGGG + Intergenic
1147584154 17:41643427-41643449 ACCGTGATCCACAGCCCCATGGG + Intergenic
1151170295 17:72239978-72240000 ACAGAGATATACAGAGACAGAGG - Intergenic
1151375113 17:73683105-73683127 AGAGAGAGGCACAGGCACAGGGG - Intergenic
1156320777 18:36019694-36019716 GCAGAAATCCACAAGCACAGAGG + Intronic
1156448871 18:37255199-37255221 ACAGAGATGCACAGCCACCCGGG + Intronic
1158465286 18:57684845-57684867 ACAGAGACACACAGACACACGGG + Intronic
1158493074 18:57928160-57928182 TCAGAGAACCACAGCAACACAGG + Intergenic
1158639619 18:59192506-59192528 ACAGAGACCTCAAGCCACAGTGG + Intergenic
1158703592 18:59770972-59770994 GCAGAGCTCCACTGCCTCAGTGG - Intergenic
1158827143 18:61235376-61235398 ACAGAGATAGACACGCACAGTGG - Intergenic
1158869409 18:61670115-61670137 ACACAGAGACACAGACACAGAGG - Intergenic
1160900888 19:1427789-1427811 ACAGACAGCAGCAGCCACAGAGG - Intronic
1161626850 19:5332059-5332081 ACAGAAATCCAGGGCCACCGTGG - Intronic
1162068547 19:8140174-8140196 ACAAAAATGCTCAGCCACAGTGG + Intronic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163032105 19:14551528-14551550 ACTGAGAGGCACTGCCACAGGGG - Intronic
1163670708 19:18626739-18626761 ACAGACATCCACCACCACACCGG + Intergenic
1164676496 19:30104928-30104950 ACAGAGCTCCATGGACACAGGGG - Intergenic
1164773763 19:30834436-30834458 ACAGAGATAGACATGCACAGAGG + Intergenic
1164961605 19:32435811-32435833 ACAGAGATCCACAGCCACAGAGG - Intronic
1167315916 19:48762576-48762598 ACAGAGATCCACAGACAGAGGGG + Intergenic
1167368460 19:49066607-49066629 ACAGAGACCCACAGACAGAAGGG - Intergenic
1167384617 19:49156514-49156536 ACAGAGATCCACAGAGAGAGGGG - Intergenic
1167384628 19:49156560-49156582 ACAGAGACCCACAGAGAGAGGGG - Intergenic
1167384633 19:49156584-49156606 ACAGAGATCCACAGAGAGAGGGG - Intergenic
1167384644 19:49156630-49156652 ACAGAGACCCACAGAGAGAGGGG - Intergenic
1167384831 19:49157296-49157318 ACAGAGACCCACAGAGAGAGGGG - Intergenic
1167384852 19:49157385-49157407 ACAGAGACCCACAGAGAGAGGGG - Intergenic
1167413202 19:49356931-49356953 ACAGAGACCCAGAGACAGAGGGG - Intronic
1167413212 19:49356979-49357001 ACAGAGACCCATAGACAGAGGGG - Intronic
1167427666 19:49437738-49437760 ACAGAGACCCAGAGATACAGGGG + Intronic
1167427670 19:49437762-49437784 ACAGAGACCCAGAGACATAGTGG + Intronic
1167427706 19:49437940-49437962 ACAGAGACCCAGAGATACAGCGG + Intronic
1167427710 19:49437964-49437986 ACAGAGACCCAGAGACATAGCGG + Intronic
1167485073 19:49758043-49758065 ACAGAGACCCAGAGACAGAGGGG - Intronic
1167564793 19:50249438-50249460 ACAGAGACCCAGAGACAGAGAGG - Intronic
1167690249 19:50980642-50980664 ACAGAGATCCAGAGAGAGAGGGG + Intronic
1167690428 19:50981420-50981442 ACAGAGATCCAGAGAGAGAGGGG + Intronic
1167740607 19:51322918-51322940 ACAGAGACCCAGAGGCAGAGGGG - Intronic
1167740626 19:51323010-51323032 ACAGAGACCCAGAGACAGAGGGG - Intronic
1167740664 19:51323221-51323243 ACAGAGACCCAGAGACAGAGGGG - Intronic
1167978958 19:53256242-53256264 ACAGAGACCCAAAGAGACAGTGG - Intergenic
1168072029 19:53958711-53958733 AGAGAGATCCAGAGAAACAGAGG - Intergenic
1168304449 19:55427851-55427873 ACAGAGACAGACAGACACAGAGG + Intergenic
1168638197 19:58012672-58012694 AAAGATCTCCACGGCCACAGTGG + Intergenic
925400759 2:3570629-3570651 ACAGAGTGCCACAGACAGAGTGG - Intergenic
925524335 2:4783127-4783149 ACTGAGAGCCACAGACAAAGGGG - Intergenic
926767714 2:16336903-16336925 AGAAAGATCCCCAGCCAGAGAGG + Intergenic
927646130 2:24878025-24878047 ACAGAGGTCCACAGCCCCTGGGG + Intronic
928308088 2:30187702-30187724 ACAGAGATACAGACACACAGGGG + Intergenic
929114480 2:38432778-38432800 CCAGAGACTCACAGCCACAGTGG + Intergenic
930897576 2:56463866-56463888 CCAGAGGTCCACAGCGAGAGTGG - Intergenic
931636148 2:64342175-64342197 ACAGAGATAGACACACACAGAGG + Intergenic
932855328 2:75227703-75227725 ACTAAGACCCAAAGCCACAGTGG - Intergenic
933154469 2:78957863-78957885 ACAAAGATCCTCAGTCATAGAGG + Intergenic
933353602 2:81188391-81188413 TCAGAGATCCACAGCTACCCGGG - Intergenic
933688871 2:85163813-85163835 ACAGAGACAGACATCCACAGAGG - Intronic
934014593 2:87866604-87866626 CCAAAGATCCACAGCCACGCAGG + Intergenic
934538578 2:95157055-95157077 AAAGAGTGTCACAGCCACAGTGG - Intronic
935065141 2:99641009-99641031 TCAGATGCCCACAGCCACAGAGG + Intronic
935406089 2:102710847-102710869 TCAAAGATCCACAGTCACATTGG - Exonic
935609131 2:105002582-105002604 ACAGACATCCAAAGTCACAGAGG + Intergenic
935724409 2:106010444-106010466 GCAAAGTTCCACTGCCACAGCGG - Intergenic
935728142 2:106041805-106041827 ACAGAGATGCACAGACACTTGGG + Intergenic
936960577 2:118069646-118069668 ACAGAGACACACATGCACAGGGG + Intergenic
936982105 2:118274465-118274487 ACAGAGATGCAGATTCACAGAGG - Intergenic
937226464 2:120373117-120373139 ACAGACATACACACACACAGAGG + Intergenic
937562073 2:123238431-123238453 CCAGAGATCCAAAGTCAGAGTGG - Intergenic
939786417 2:146519156-146519178 ACTGAGATCCACAGGTACACTGG + Intergenic
940398521 2:153221548-153221570 AAAGGCACCCACAGCCACAGAGG - Intergenic
941850852 2:170178402-170178424 ACAGAGGCCCAAAGCCAGAGTGG - Intronic
942076255 2:172359445-172359467 ACGGAGATCAACACCCATAGAGG - Intergenic
944841068 2:203624204-203624226 ACAGGGACCCAGAGACACAGAGG - Intergenic
945538644 2:211054123-211054145 ACACAGTCCCACAGCCACTGAGG - Intergenic
947263678 2:228252538-228252560 CCAGAGGTCCATAGCAACAGTGG + Intergenic
947746243 2:232508688-232508710 ACACACACCCACAGCCACACTGG + Intergenic
948441463 2:237993313-237993335 ACAGACATCCACAGTCACCACGG - Intronic
1168888565 20:1277643-1277665 ACACAGATACACAGACACACAGG - Intronic
1168888572 20:1277814-1277836 ACACAGATACACAGACACACAGG - Intronic
1168989985 20:2086851-2086873 ACATAGATCTAAAGTCACAGTGG + Intergenic
1169500781 20:6158372-6158394 CCAGAGGTCCACAGCAAGAGTGG + Intergenic
1170695005 20:18650085-18650107 ACAGACATGCACCACCACAGTGG - Intronic
1171402334 20:24882921-24882943 ACAGAGATGCAGAGAGACAGAGG + Intergenic
1173059910 20:39651124-39651146 ACAGAGAACTCCAGGCACAGGGG - Intergenic
1173270832 20:41533244-41533266 ACAGAGAGCCCAAGCCAAAGAGG - Exonic
1174186340 20:48708870-48708892 AGAGAGATCCGCGGTCACAGAGG + Intronic
1174615674 20:51833617-51833639 ACAGAGAGCCACAGACGGAGCGG + Intergenic
1175706278 20:61179716-61179738 ACAGGGATCCACACACACAATGG - Intergenic
1176028795 20:63000270-63000292 CCAGAAACGCACAGCCACAGAGG + Intergenic
1176043389 20:63079997-63080019 CAAGAGACACACAGCCACAGAGG + Intergenic
1177185735 21:17793813-17793835 ACAGAGATACACAGCAAAAATGG + Intronic
1178754681 21:35337318-35337340 ACAGAGACCCACAGTCTCAGTGG + Intronic
1179028941 21:37703286-37703308 ACAGGGCTCCACAGCAACAGGGG + Intronic
1179166381 21:38938387-38938409 ACAGAGACCCAGAGACCCAGAGG - Intergenic
1180821475 22:18831826-18831848 AGAGGGATGCCCAGCCACAGAGG + Intergenic
1181191503 22:21144219-21144241 AGAGGGATGCCCAGCCACAGAGG - Intergenic
1181207695 22:21266291-21266313 AGAGGGATGCCCAGCCACAGAGG + Intergenic
1182421962 22:30252963-30252985 ACAGGCATGCACAGACACAGAGG - Intergenic
1182423196 22:30258305-30258327 AGAGAGAGCCTCAGCCACACTGG + Intergenic
1183170212 22:36182324-36182346 ACAAAGCACCACAGACACAGTGG + Intergenic
1184470612 22:44693573-44693595 ACAGAGATACAGAGACCCAGAGG - Intronic
1184638258 22:45853378-45853400 AGAGAAATCCACAATCACAGTGG + Intergenic
1185020615 22:48372625-48372647 ATAGAGGGCCAAAGCCACAGTGG - Intergenic
1185232506 22:49691281-49691303 CCAGAGGTCCACATGCACAGAGG + Intergenic
1185297329 22:50060856-50060878 AGAGGGATCCACCGCCACACTGG - Exonic
1203219225 22_KI270731v1_random:29125-29147 AGAGGGATGCCCAGCCACAGAGG - Intergenic
1203271600 22_KI270734v1_random:57702-57724 AGAGGGATGCCCAGCCACAGAGG + Intergenic
949681782 3:6522188-6522210 ACAGAGAAACACAGCCAAATTGG - Intergenic
949719143 3:6968265-6968287 ACAGAGACAGACAGGCACAGAGG - Intronic
951448890 3:22814212-22814234 AGAGAGATCAATAGACACAGTGG + Intergenic
953236800 3:41114071-41114093 AGAGAGATCCAAAGCAACACTGG + Intergenic
953253239 3:41265187-41265209 TCTCAGATCCACGGCCACAGGGG + Intronic
953465173 3:43113582-43113604 ACAGAGATCCACACAGAAAGTGG + Intergenic
953602396 3:44379692-44379714 ACAGAGAACAACAGACACTGGGG + Intronic
954132028 3:48565734-48565756 ACAGAGACACACAGGCAGAGGGG + Intronic
954871883 3:53773518-53773540 GCAGAGATCTACAGCCACCTGGG - Intronic
957159026 3:76584543-76584565 ACAGCCATCCACAGCCAAAAAGG + Intronic
960302588 3:116022087-116022109 AAAGAGATCCAGAGGCACATGGG - Intronic
960465336 3:117990855-117990877 ACAGAGTTACACAGCCACAGTGG + Intergenic
961861929 3:129923766-129923788 ACAGAGAGACAGAGGCACAGAGG + Intergenic
962270870 3:133977165-133977187 ACACAGATACACACACACAGAGG + Intronic
962844812 3:139264935-139264957 ACAGAGACCCACAGCCAAGCAGG + Intronic
966665119 3:182463584-182463606 AGAGAGGTGCAAAGCCACAGGGG + Intergenic
967256015 3:187592615-187592637 GCAGAAATTCACAGCCCCAGAGG - Intergenic
967427227 3:189340916-189340938 ACTGAGATCCAGAGACAGAGAGG - Intergenic
968035772 3:195546272-195546294 ACAGAGTTCCAAAGCAACAGTGG + Intergenic
968647123 4:1746610-1746632 ACAGGGATGGACGGCCACAGCGG + Intergenic
969041952 4:4305697-4305719 ACAGAGAGCCCCAAACACAGTGG - Intronic
969624800 4:8297018-8297040 ACAGGGTTCCCCAGCCTCAGAGG + Intronic
970917371 4:21351715-21351737 ACAGACATGCACATGCACAGAGG + Intronic
971052346 4:22875528-22875550 ACAGCGACACACAGACACAGAGG + Intergenic
972281047 4:37602461-37602483 ACAGAGTTCCATAGCCTCATGGG - Intronic
974786130 4:66621546-66621568 AGAGATATCCACACCCCCAGTGG + Intergenic
974836694 4:67259873-67259895 ACAGGGATACACAACCTCAGAGG + Intergenic
975461966 4:74664465-74664487 AAAAAAATCCACAGCCACTGGGG + Intergenic
978053956 4:104239576-104239598 ACAGAGATGCACATCCCCACTGG - Intergenic
982068614 4:151675568-151675590 ACAGGGCTCGGCAGCCACAGAGG - Intronic
982493753 4:156063985-156064007 AGAGAGTCCCACAGCCTCAGTGG - Intergenic
982686251 4:158493115-158493137 ACAGAGATCCCAAGCAAGAGAGG + Intronic
982695734 4:158597880-158597902 TCAGACATCCACAACCAAAGTGG + Intronic
983581662 4:169315777-169315799 ATAGAACTACACAGCCACAGGGG - Intergenic
983815615 4:172122732-172122754 AAAGAGAACCATGGCCACAGTGG - Intronic
985330346 4:188824718-188824740 ACAGGGACGCACAGACACAGGGG + Intergenic
986146263 5:5080707-5080729 ACACAGATACACAGCCACAATGG - Intergenic
986488890 5:8269341-8269363 ACACAGAGCCTCAGCCACCGTGG - Intergenic
986719012 5:10546598-10546620 ACAGAGACCCAGACACACAGTGG - Intergenic
988722565 5:33892677-33892699 ACAGAGATCTGCAGACTCAGAGG - Intergenic
989118301 5:37978115-37978137 ACAGAGACAGACAGACACAGAGG - Intergenic
992969978 5:82046371-82046393 ACAGAGACCCAGACACACAGGGG + Intronic
996111224 5:119569049-119569071 ACAGAGTTCTCCATCCACAGAGG - Intronic
998978723 5:147676674-147676696 ACAGAGAAACTCAGCCTCAGAGG - Intronic
999025224 5:148221760-148221782 ACTGAGAACCACAGGGACAGTGG + Intergenic
999037052 5:148363504-148363526 ACAGAGGTCCCCAGCAAAAGAGG + Intergenic
1000524355 5:162337347-162337369 ACAGAAATCCACAGCAACAAAGG - Intergenic
1000865007 5:166502666-166502688 ACACAGATGCACAGACACTGAGG + Intergenic
1001772090 5:174304237-174304259 ACAGAGACACAGAGACACAGAGG - Intergenic
1001867835 5:175120878-175120900 ACAGAGATGCACAGACAGGGAGG - Intergenic
1002693327 5:181066121-181066143 GCAAAGTGCCACAGCCACAGAGG - Intergenic
1005245380 6:23878401-23878423 AGACAGATCCACAGACACACAGG - Intergenic
1008613710 6:53206737-53206759 ACAGAGGCCCAAAGCCACTGAGG + Intergenic
1009464624 6:63954141-63954163 TCAGAGATATACAGTCACAGGGG - Intronic
1009995187 6:70888893-70888915 AGAGAAAACCACAGCCACTGGGG - Intronic
1012638048 6:101572171-101572193 ACAGATATTAGCAGCCACAGAGG + Intronic
1012808397 6:103925695-103925717 ACAGAGCAACACAGCTACAGAGG + Intergenic
1015582091 6:134736687-134736709 ACAGAGAGTAACATCCACAGAGG + Intergenic
1016548616 6:145252111-145252133 GGAGAGATCAACAGCAACAGAGG - Intergenic
1018163083 6:161066765-161066787 CCAGACCTCCACAGTCACAGAGG - Intronic
1019647648 7:2139591-2139613 TGAGAACTCCACAGCCACAGAGG + Intronic
1019647656 7:2139638-2139660 TGAGAACTCCACAGCCACAGAGG + Intronic
1019730824 7:2628468-2628490 TCAGAGATACAGAGACACAGAGG - Intergenic
1021103150 7:16606905-16606927 CCAGAGTTCCACAGCAGCAGAGG + Intronic
1021157840 7:17234101-17234123 AAAGAGATCCACACAGACAGTGG + Intergenic
1022198803 7:28095773-28095795 ACAGAATACCACAGCCAGAGTGG + Intronic
1022911496 7:34903141-34903163 ACAGTGTTCCACAAACACAGTGG - Intergenic
1023652074 7:42381923-42381945 AAAGAGATCCAGAACTACAGTGG + Intergenic
1023904661 7:44513660-44513682 ACAGAGAACCACAGTCAGAGAGG + Intronic
1024001293 7:45190907-45190929 CCAGAGGTCCAAAGCCCCAGGGG - Intergenic
1026871810 7:73857325-73857347 CCAGAACTCCACTGCCACAGAGG - Intergenic
1026894881 7:74004216-74004238 ACAGAGACACACAGCAACACCGG - Intergenic
1028109459 7:86921382-86921404 ACAGAGACACACAGACCCAGAGG + Intronic
1031478535 7:122250974-122250996 ACATTCATCCACAGGCACAGAGG + Intergenic
1031901236 7:127413857-127413879 ACAGAGATACATACACACAGGGG - Intronic
1031937224 7:127748168-127748190 ACAAAGAATCACAGGCACAGTGG - Intronic
1035299286 7:157886902-157886924 TCACAGATCCAAACCCACAGTGG + Intronic
1035355439 7:158273683-158273705 ACAGGGAGCCGCAGACACAGGGG + Intronic
1035355506 7:158274000-158274022 ACAGGGAGCCGCAGACACAGGGG + Intronic
1035355536 7:158274138-158274160 ACAGGGAGCCGCAGACACAGGGG + Intronic
1035355569 7:158274305-158274327 ACAAGGAGCCGCAGCCACAGGGG + Intronic
1035624432 8:1060491-1060513 ACAGAGACCCACAGAGAGAGGGG - Intergenic
1037825451 8:22158046-22158068 ACAGTCATCCTCCGCCACAGGGG - Intronic
1038318269 8:26506460-26506482 CCAGAGGTCCACAGCCTGAGAGG - Exonic
1038451984 8:27645645-27645667 ATAGAGAACCACAGCCTGAGAGG - Intronic
1038482357 8:27910409-27910431 ACAGAGATAGTAAGCCACAGCGG + Intronic
1039404932 8:37304348-37304370 ACACACACACACAGCCACAGAGG - Intergenic
1040434766 8:47379764-47379786 ACAGAGCTCCGCAGGCACATGGG - Intronic
1040850843 8:51899114-51899136 GCAGAGAACCACGGGCACAGGGG + Intronic
1041660168 8:60393490-60393512 GCAAAGAGCCACATCCACAGTGG - Intergenic
1043626547 8:82267852-82267874 ACACAGATACACAGACACAGAGG + Intergenic
1044281954 8:90366883-90366905 ACAGAGATACATATACACAGAGG - Intergenic
1045042168 8:98236371-98236393 CCACATATCCTCAGCCACAGGGG - Intronic
1045317168 8:101053144-101053166 TCAGAGAGGCCCAGCCACAGGGG - Intergenic
1046010411 8:108539583-108539605 ACAGATACACACAGACACAGAGG + Intergenic
1046760551 8:118015880-118015902 AGAGAGATGCACAGACACAGAGG + Intronic
1047399145 8:124531500-124531522 ACTGAATTCCACAGCGACAGAGG - Intronic
1047438367 8:124854741-124854763 ACAGTGATCCACACTCAAAGGGG + Intergenic
1048208177 8:132432134-132432156 ACAGAAATTCACATCCCCAGGGG + Intronic
1053826505 9:42030429-42030451 ACACAGACCCAGAGCCAAAGGGG - Intronic
1054604055 9:67156968-67156990 ACACAGACCCAGAGCCAAAGGGG + Intergenic
1055718883 9:79149295-79149317 ACAGAGATCCCAAGCCTGAGGGG - Intergenic
1056824084 9:89864786-89864808 ACAGAAATTCTCAACCACAGAGG + Intergenic
1057419856 9:94902703-94902725 ACACAGATACAGAGCCCCAGGGG - Intronic
1057512151 9:95689747-95689769 TGAGAGAGCCACACCCACAGGGG - Intergenic
1058683485 9:107460393-107460415 ACAGATATCTACAGCCAGAGCGG + Intergenic
1058952105 9:109913712-109913734 ACAGAGACCCACAATAACAGTGG + Intronic
1058955575 9:109943838-109943860 ACAAAGATCCACAGCAAAGGAGG - Intronic
1060030559 9:120211571-120211593 ACAGAGACACATAGACACAGAGG + Intergenic
1061318995 9:129815922-129815944 GGACAGACCCACAGCCACAGGGG - Intronic
1062077567 9:134599356-134599378 ACAGAGAGACACAGAGACAGAGG + Intergenic
1185491564 X:521272-521294 CCAGAGCTCCACTGCCAAAGAGG - Intergenic
1185505004 X:625551-625573 ACAGAGATACAGAGAGACAGAGG - Intronic
1185721902 X:2389050-2389072 ACAGAGATCCACAGACCAGGTGG - Intronic
1186403046 X:9277268-9277290 ACAGAGACAGACAGACACAGAGG - Intergenic
1186432443 X:9516465-9516487 AGAGAGAGCCACAGGCACACTGG + Intronic
1186543870 X:10428627-10428649 ACAGAGAACCACAGTCTAAGAGG - Intergenic
1186566627 X:10669948-10669970 ACAGATATTCAAAGCCACTGAGG - Intronic
1186728378 X:12381910-12381932 ACATAGAAACAGAGCCACAGGGG + Intronic
1189000477 X:36938662-36938684 ACAGAGAAACACATACACAGAGG + Intergenic
1189122075 X:38405438-38405460 ACAGAGAGACACAGACACAGAGG - Intronic
1190907280 X:54739405-54739427 ACTGAGATACACAGACACTGGGG - Intergenic
1192226017 X:69228452-69228474 GCAGGGATCCACAGCCACAGTGG + Intergenic
1192534307 X:71914121-71914143 CCACAGATCCACAACCACAGGGG - Intergenic
1193251692 X:79298684-79298706 CCAGAGGTCCACAGCAAAAGTGG - Intergenic
1193725027 X:85028107-85028129 ACAGATTACCACAGCCTCAGTGG + Intronic
1195405442 X:104508027-104508049 TCAGAGATGGATAGCCACAGAGG + Intergenic
1196711523 X:118768682-118768704 ACAGAGACACACAGACACACAGG + Intronic
1198524892 X:137491210-137491232 ACAGGGATGCACATGCACAGAGG + Intergenic
1199548768 X:149035491-149035513 CCAGGGATCCACAACCACTGAGG + Intergenic
1199903525 X:152201505-152201527 ACAGAGAGACACAGCAATAGGGG - Intronic
1199984980 X:152944025-152944047 ACAGAGAAGCACAGGCCCAGTGG + Intronic
1200103049 X:153697785-153697807 AGGGAGATCCACAGAGACAGAGG + Intergenic