ID: 1164961724

View in Genome Browser
Species Human (GRCh38)
Location 19:32437127-32437149
Sequence GTTTTAAATGGCACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164961719_1164961724 3 Left 1164961719 19:32437101-32437123 CCTGCATATTGTATTCCTACTGT 0: 1
1: 0
2: 0
3: 16
4: 191
Right 1164961724 19:32437127-32437149 GTTTTAAATGGCACTGAGGAGGG 0: 1
1: 0
2: 0
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164961724 Original CRISPR GTTTTAAATGGCACTGAGGA GGG Intronic
900648607 1:3720283-3720305 GTTTTAAACAGGACTGGGGATGG + Intronic
902170089 1:14603247-14603269 TTTTCAAATGGCAGAGAGGATGG + Intronic
902201219 1:14835237-14835259 GCCTTAAAGGGCAGTGAGGAAGG + Intronic
902640247 1:17762396-17762418 GTTTTAAATGGCCCAGGGGGTGG - Intronic
903312452 1:22470330-22470352 GTTTTAAGTGGCATGAAGGAAGG + Intronic
906522980 1:46478113-46478135 GTGCTAATTGGCACAGAGGAGGG + Intergenic
908043858 1:60146945-60146967 GGTATAAAAGGCACTGAGGTAGG - Intergenic
908893695 1:68875152-68875174 GTTTTTAATGGCATCGAGAATGG - Intergenic
909771432 1:79427118-79427140 GTTTGAAATTGTACTGTGGAAGG + Intergenic
910552229 1:88488308-88488330 GTTTTAAATGGCTGTGAGCCAGG + Intergenic
910616172 1:89200767-89200789 GTTTTTAATCTCACTGAGCAAGG + Intergenic
911992048 1:104711380-104711402 ATTTTAAATGTCACTAATGATGG + Intergenic
912032834 1:105271413-105271435 GTTCTTAATGGCACTTAGAATGG - Intergenic
912079386 1:105915988-105916010 GTTTTAAAAGGAACGGGGGATGG - Intergenic
914743560 1:150484940-150484962 TTTTTAAATGGCATTCAGAAAGG - Intergenic
915459158 1:156059489-156059511 CCTTTATATGGCACTGGGGAAGG - Intergenic
915613871 1:157019205-157019227 GTTTTAAAAGACACTGAAAATGG + Intronic
915828136 1:159100875-159100897 AATCTAAAGGGCACTGAGGATGG + Intronic
915845210 1:159256124-159256146 GTTTTTAATGGCACTTAGAATGG + Intergenic
916832024 1:168502925-168502947 TTTTCAGATGGCACTGAGGAAGG + Intergenic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
917328090 1:173853819-173853841 GTTTTAAATGGCAATGAAATAGG + Exonic
917644062 1:177012602-177012624 GTTTTAAATGACACTTATGCTGG + Intronic
917879103 1:179316048-179316070 GTTGTAAATGGCAAGGAGAATGG - Intronic
919217376 1:194576163-194576185 GTTTTTAATGGCACCTAGAATGG - Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
921379407 1:214508639-214508661 GTTGTTAATGGCACTGAGAATGG + Intronic
924297398 1:242601959-242601981 GTATTTAATGGCACAGAGGTGGG + Intergenic
924834830 1:247637769-247637791 ATTTTAAGTGGCAATTAGGATGG - Intergenic
1063610636 10:7558938-7558960 GTTAGAAATGGCACCTAGGAGGG + Intergenic
1064189085 10:13189652-13189674 ATTTTTAATGGCCCTGATGAAGG - Intronic
1065455094 10:25898946-25898968 GTTTTTAAAGGCAGTGAGGCAGG + Intergenic
1065962963 10:30749162-30749184 CTTTTAAAAGGCACAGGGGAGGG - Intergenic
1066478879 10:35775827-35775849 GTTTTTAATGGCATTTAGAATGG + Intergenic
1069714451 10:70511729-70511751 ATTTTAAAAGGCATTGAGGGCGG + Intronic
1070222780 10:74468147-74468169 GTATTAAAAGGCCCTTAGGAAGG + Intronic
1070371129 10:75783076-75783098 CTTTTAAATAGCAATGATGAAGG + Intronic
1072469382 10:95698117-95698139 ATTTGAGATGGAACTGAGGAAGG + Intergenic
1073165447 10:101445108-101445130 GTTATTAATGGCATTGAAGATGG + Intronic
1075154331 10:119961882-119961904 GTTTGCAATTGCACTGGGGAGGG - Intergenic
1076088128 10:127653785-127653807 GTTTGAAATGGGAATGAGGATGG - Intergenic
1078169667 11:8919931-8919953 GTTAAAAAAGGCACTGAGGCCGG - Exonic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1079914233 11:26348720-26348742 ATTTTACAAGGCACTGTGGAAGG + Intronic
1080553063 11:33390666-33390688 GTTTTAAATGTCAGTTTGGAGGG + Intergenic
1080892447 11:36421171-36421193 CTTTTAAATGTCAAGGAGGAAGG - Intronic
1083040024 11:59676622-59676644 GTTCTTAATGGCATTTAGGATGG + Intergenic
1085864286 11:80270340-80270362 TTTTAAAATGTCACTGAAGAGGG + Intergenic
1087149143 11:94842931-94842953 GTTTTAAATGGCAGAGAGAGTGG - Intronic
1087741661 11:101894895-101894917 TTTTTAAAATGCACTTAGGACGG - Exonic
1088013056 11:105026528-105026550 GATTTAAAATGCCCTGAGGAGGG - Intronic
1088706342 11:112467730-112467752 GTTTTGATTGGGGCTGAGGAGGG + Intergenic
1089089665 11:115860442-115860464 GTTTTAAAAGGGATGGAGGAAGG + Intergenic
1090107462 11:123868309-123868331 TTTTTAAAGTGCACTGCGGATGG + Intergenic
1090610792 11:128468554-128468576 GGTTGAAATGGAAATGAGGAAGG - Intronic
1094351713 12:29533336-29533358 GGTTTTATTGGCACTGAGGATGG + Intronic
1094424273 12:30302486-30302508 GTTTTAAATCACACAGAGGAAGG + Intergenic
1097358241 12:58626879-58626901 GTTTGAAATGCCATTTAGGAAGG + Intronic
1100305811 12:93349123-93349145 ATTTTAAATGGCAATGGCGAGGG + Intergenic
1102995588 12:117347582-117347604 GTTTTAAAGGGCAACAAGGAAGG + Intronic
1103113953 12:118309036-118309058 ATTTTAAATGTCACTGGGCACGG + Intronic
1106419776 13:29576680-29576702 GTTTCAAATGGCACTAGAGATGG - Intronic
1108667985 13:52652070-52652092 GGGTTAAAGGGCGCTGAGGAAGG + Intergenic
1109111284 13:58321474-58321496 ATTTTAAATGACAGTCAGGATGG + Intergenic
1110403627 13:75122947-75122969 GATTTACATGCCACTTAGGATGG - Intergenic
1110472983 13:75881382-75881404 GTATTACATGGCACTGGGGGAGG - Intronic
1111065465 13:83086022-83086044 ATATTAAATGACACAGAGGATGG + Intergenic
1111922224 13:94424360-94424382 GGATTAAATGGCAAGGAGGAGGG - Intergenic
1112590081 13:100754911-100754933 GTTTTAAATGGGATTGATGAAGG - Intergenic
1117940905 14:60963503-60963525 TTTTTAAATCTCACTGAGGTAGG + Intronic
1119080486 14:71688682-71688704 ATTGTAAATGGCACTCAGGACGG - Intronic
1119110372 14:71967821-71967843 CTTTTAAATGACATTTAGGATGG + Intronic
1119125119 14:72118141-72118163 TTTTTAAATGGCAGTGAGGGTGG - Intronic
1119626645 14:76182810-76182832 GTTTGAAAAAGCACAGAGGAGGG + Intronic
1121556948 14:94845335-94845357 ATTTTGAATGGCCCTGGGGAAGG + Intergenic
1121973046 14:98376644-98376666 GTTGCAAATGGCAATGGGGATGG - Intergenic
1126456128 15:48864320-48864342 GTTCTAAATGGCACTGGAGGAGG - Intronic
1130215387 15:81963888-81963910 GTTTTAGCTGCCTCTGAGGAGGG - Intergenic
1130654042 15:85779454-85779476 GTATTAAAATGCAATGAGGAGGG + Intronic
1130923897 15:88371017-88371039 GTTTCAAAAGGCAAAGAGGAAGG - Intergenic
1131084694 15:89566511-89566533 GTTTTAACTTTCTCTGAGGAAGG - Intergenic
1132086730 15:98914378-98914400 AGTTTAAATGGCAGAGAGGAGGG + Intronic
1132338488 15:101063793-101063815 TTTTTAAATGAAACTGAAGAAGG - Intronic
1139479876 16:67224557-67224579 GTCCTAAATGGGACTGGGGAAGG + Intronic
1146516323 17:33492594-33492616 GTTTTAAATGGGGCAAAGGAAGG - Intronic
1150156231 17:62855689-62855711 GTTTAAAATGGCAGAGAGGCTGG + Intergenic
1153406760 18:4749371-4749393 GTTTTAAGTGGTGCTGAGGTAGG - Intergenic
1156058183 18:33036770-33036792 GTTTTAAATAGCTGTGAGGAGGG + Intronic
1161633560 19:5372024-5372046 CGTTTAAATGGCTCTGAGGGAGG + Intergenic
1164820435 19:31246591-31246613 GTTTAAAAAGGGACAGAGGAAGG + Intergenic
1164961724 19:32437127-32437149 GTTTTAAATGGCACTGAGGAGGG + Intronic
1165742628 19:38212577-38212599 GTTTTATAAGGCTCTGTGGAAGG + Intronic
1167699492 19:51034091-51034113 ATTTTCAATGGCACTGAGTGTGG - Exonic
1167934828 19:52897473-52897495 GTTTAAAGTGGCCCTGAGGCAGG - Intronic
1167987884 19:53333957-53333979 GTTTAAAGTCGCCCTGAGGATGG + Intronic
924969543 2:112867-112889 ATTTTAAATGGCCCTCTGGAAGG - Intergenic
925343999 2:3157116-3157138 GTCTTAAAGGGACCTGAGGAGGG + Intergenic
925448303 2:3946982-3947004 GTTTTAAATGTCAAAGGGGAAGG - Intergenic
928553535 2:32398284-32398306 CTTTTAAATGCCAATCAGGAGGG + Intronic
928726669 2:34181929-34181951 GTTCTTAATGGCACTTAGAATGG - Intergenic
929133368 2:38600801-38600823 GGTGGAAATGGCACTGAGTAGGG - Intronic
929525465 2:42698403-42698425 GTTTTAAATGAGGCTGAGCATGG + Intronic
931407757 2:61996938-61996960 GTTCTTAATGGCACTTAGAATGG + Intronic
931858362 2:66327974-66327996 GTTGGAAATGTCACTGAGGCCGG + Intergenic
932038765 2:68276451-68276473 GTTTAAAATGCCACCGAAGATGG + Intergenic
932919655 2:75896560-75896582 GTTTGAAAAGGCACAGAAGAAGG + Intergenic
935737858 2:106120499-106120521 GTGAGAAATGGCACCGAGGAAGG - Intronic
936553146 2:113468129-113468151 GTTTGAAGTGCCACTGGGGAAGG + Intronic
936705609 2:115069284-115069306 GTTTTAAATGATACTGTGAATGG + Intronic
937208377 2:120251734-120251756 GTTTTAAATGTGAATGAGAATGG + Intronic
938668841 2:133567424-133567446 GTTTTAAAGAGCCCTGAGGCAGG + Intronic
939519016 2:143205678-143205700 GTTTGAGAAGGCACTGATGAAGG - Intronic
940640086 2:156335054-156335076 GTTTTTAATGGCAATGAGGGAGG - Intronic
941015319 2:160349688-160349710 GCTTTATATGGCACAAAGGAAGG - Intronic
941882827 2:170499166-170499188 GTTTTATAAGGCAATCAGGATGG - Intronic
946197049 2:218039779-218039801 GATTTAAATGGCTCTGAGGCTGG - Intronic
947050490 2:226037416-226037438 GTTCTTAATGGCACTGAGAATGG - Intergenic
947085216 2:226443632-226443654 GTGCAAAATGGCAGTGAGGAGGG - Intergenic
948547706 2:238744685-238744707 GTTTTAATGAGCACTTAGGATGG + Intergenic
1170317355 20:15057031-15057053 GAATTAAATGGAATTGAGGATGG + Intronic
1170400672 20:15979715-15979737 GTTTTAAATGCTACAGGGGAGGG + Intronic
1170900827 20:20461569-20461591 TCTTTAAATTCCACTGAGGATGG + Intronic
1170943729 20:20871007-20871029 GGTTTAAAGGGCACTAAAGAAGG - Intergenic
1172268607 20:33639145-33639167 GGAATAAGTGGCACTGAGGAAGG - Intronic
1173152657 20:40581085-40581107 GTTTTCAATGACATTGGGGAAGG - Intergenic
1174532298 20:51223784-51223806 GTGTTAAGTGGCAAGGAGGACGG + Intergenic
1177689520 21:24486849-24486871 GCTTTAAATGGAACTGATGCTGG - Intergenic
1183669231 22:39262575-39262597 GCTGTCAATGGCTCTGAGGAAGG - Intergenic
951036390 3:17937371-17937393 GTTATAAAAGGGACTTAGGACGG - Intronic
951775989 3:26310885-26310907 GATAAAAATGGCACTAAGGAAGG - Intergenic
951877879 3:27447678-27447700 GTTTTAAGTGGCCCTGAGAGTGG - Intronic
956981650 3:74645678-74645700 GTTTTAAAAGGCTATGAGAAAGG + Intergenic
957999362 3:87731909-87731931 TTTTGAAATGGAAATGAGGAGGG + Intergenic
958513431 3:95080019-95080041 GATGTAAATAACACTGAGGAAGG - Intergenic
960128087 3:114022776-114022798 GTTTTAAGTTGAAATGAGGAAGG + Intronic
961392314 3:126559546-126559568 GTGTTAAATAGAACTGGGGAAGG + Intergenic
961583784 3:127905081-127905103 GCTTTGTATGGAACTGAGGATGG - Intergenic
963918475 3:150882994-150883016 GTCTTCAATGGCTGTGAGGAAGG - Exonic
964061432 3:152529042-152529064 GTTCTAAATGGCAGTTAGAATGG + Intergenic
964410421 3:156391811-156391833 GACTTAGATGGCACAGAGGAGGG + Intronic
965359617 3:167722485-167722507 GTTTTAAGTGCTACTGAGTATGG + Intronic
965925725 3:173977312-173977334 GTCTTAAATGGGAGTGGGGATGG + Intronic
966927347 3:184653633-184653655 GATTTAAATGGCATTCAGGCTGG + Intronic
967048647 3:185761507-185761529 GTCTTAAATAGCACTTGGGATGG - Intronic
967432969 3:189409479-189409501 GTTGTTTATGGCAATGAGGAAGG - Intergenic
967514924 3:190356551-190356573 GTTTTAAATCAGATTGAGGAAGG - Intronic
970237070 4:13969575-13969597 GTTTTAAATAGCAGTAAGGAAGG + Intergenic
970636387 4:18014117-18014139 ATTTTAAAGGCGACTGAGGATGG + Intronic
971912843 4:32817963-32817985 TTTGTAAATGGCACTGAGATGGG - Intergenic
972383563 4:38541844-38541866 GTTCTTAATGGCATTGAGAATGG + Intergenic
974640800 4:64627425-64627447 GTTTAAAATGGTCCTGAGTATGG - Intergenic
976039458 4:80865481-80865503 CTTTTAAATGGCACAGTTGAGGG - Intronic
977612803 4:99053559-99053581 GTTTTTAATGGCATCGAGAATGG + Intronic
979206933 4:118049030-118049052 TTTTTAAATTGCACTGAGGTTGG - Intronic
979774081 4:124565804-124565826 GTTATAATTGGAACTGCGGAAGG - Intergenic
980198451 4:129622397-129622419 GCTTTAATTGGGAGTGAGGAAGG + Intergenic
981003459 4:139851339-139851361 GTCTTAAAAGGCCCTGAAGAAGG - Intronic
983625463 4:169797579-169797601 TTTTTAAATTGCACTGAGGTTGG + Intergenic
983739068 4:171105216-171105238 GTTCTAAATGGAATTTAGGATGG - Intergenic
984077041 4:175196432-175196454 ATTTTAAATTGCACTTATGAAGG + Intergenic
984219990 4:176963181-176963203 GTTTTAAGTGGAACTGAAGAAGG + Intergenic
984948327 4:184987356-184987378 CTTCTACATGGCACTGAGGTTGG + Intergenic
987697653 5:21353594-21353616 ATTTTAGCTGGCACTGTGGAAGG + Intergenic
988754582 5:34233097-34233119 ATTTTAGCTGGCACTGTGGAAGG - Intergenic
989494026 5:42090504-42090526 GTCTTATATGTCACTGAGGAAGG - Intergenic
991660832 5:68949315-68949337 GTTGTAAATGGCATTGATGGAGG + Intergenic
991742791 5:69698794-69698816 ATTTTAGCTGGCACTGTGGAAGG - Intergenic
991754905 5:69856410-69856432 ATTTTAGCTGGCACTGTGGAAGG + Intergenic
991794364 5:70278532-70278554 ATTTTAGCTGGCACTGTGGAAGG - Intergenic
991822179 5:70574107-70574129 ATTTTAGCTGGCACTGTGGAAGG - Intergenic
991834232 5:70731558-70731580 ATTTTAGCTGGCACTGTGGAAGG + Intergenic
991886744 5:71278074-71278096 ATTTTAGCTGGCACTGTGGAAGG - Intergenic
992949318 5:81841660-81841682 GTTTTCAAAGGCAGAGAGGAGGG - Intergenic
993096296 5:83482557-83482579 GTTCTAAATGCTACCGAGGAGGG + Intronic
993409532 5:87556264-87556286 GGTTTGAAAGGCACTGAAGAAGG - Intergenic
994476392 5:100276340-100276362 GTAGTATATGACACTGAGGAAGG - Intergenic
996090124 5:119342474-119342496 GCTTTAAGTGGCTTTGAGGAAGG - Intronic
996352060 5:122555047-122555069 GTTCTTAATGGCACCTAGGATGG - Intergenic
999348908 5:150848266-150848288 GTTTCGAAGGGCACTGATGAAGG - Exonic
1000102419 5:158029061-158029083 TTTCTAAATGGCAATGTGGAAGG + Intergenic
1002302500 5:178265362-178265384 GTTTTAATTTGCACTGAAGCAGG + Intronic
1004758959 6:18644696-18644718 GTCATAAAAGGAACTGAGGAGGG + Intergenic
1004823435 6:19394766-19394788 GCTTTCAATGGCAATGAAGAAGG - Intergenic
1005553200 6:26944813-26944835 ATTTTAGCTGGCACTGTGGAAGG - Intergenic
1007055313 6:38877284-38877306 ATTTTTGATGGCACAGAGGAAGG - Intronic
1007510516 6:42371096-42371118 GTTTTACAAGGCAGTGAAGAGGG + Intronic
1007865824 6:44969008-44969030 GATTTAAATGACCCTGAAGATGG - Intronic
1008417682 6:51262058-51262080 GTCTTAAATGGCAGTGACGATGG + Intergenic
1010800918 6:80174736-80174758 ATTCTATAGGGCACTGAGGATGG + Intronic
1011240852 6:85269755-85269777 TTTTTTAATGCCACTGAGAAGGG + Intergenic
1011669820 6:89672614-89672636 GTTCTGGATGGCACAGAGGATGG + Exonic
1011811699 6:91139699-91139721 GTTTTAAATGGTAATGGTGAAGG - Intergenic
1014349482 6:120322230-120322252 GAAATAAAGGGCACTGAGGAAGG + Intergenic
1015947000 6:138513132-138513154 GTTTTGCATGGCACCGAGGTTGG - Intronic
1015997781 6:139012837-139012859 ATTTCAAATAGCCCTGAGGAGGG + Intergenic
1018406061 6:163483802-163483824 GTTCTTAATGGCATTGAGAATGG + Intronic
1020680182 7:11227310-11227332 GTTTCAAATGGCACTAAGTCAGG + Intergenic
1021621639 7:22555404-22555426 TTTTTAAATTTCTCTGAGGAGGG - Intronic
1021883684 7:25117610-25117632 GTTTTAGAAGGCACGGAGGAAGG + Intergenic
1023350649 7:39317223-39317245 GTTTTACATGCCACTGAGCTAGG - Intronic
1028975410 7:96907697-96907719 GTTTTATTTGGCATTCAGGAAGG - Intergenic
1029692728 7:102192977-102192999 GTTCTCAATGGCACTGAAAAGGG - Intronic
1032944174 7:136831061-136831083 CTTTTAAATGTTAATGAGGATGG + Intergenic
1033496353 7:141900515-141900537 AGTTTAGAAGGCACTGAGGAGGG + Intergenic
1035426154 7:158775797-158775819 GTTTTCAATGGCATCTAGGATGG + Intronic
1035455149 7:159003750-159003772 GTTTTCAATGGCATCTAGGATGG + Intergenic
1038358716 8:26856264-26856286 TTTTTAAATGGCACGGTAGAAGG + Intronic
1039071213 8:33650810-33650832 GTGATAAATGGCACTTTGGAAGG - Intergenic
1040849135 8:51880295-51880317 ATTTTAATTGCCACTGAGGTTGG - Intronic
1042212036 8:66390494-66390516 GCTTTAAAGGGAACTGAGAAGGG + Intergenic
1043818213 8:84829569-84829591 AATTTTAAAGGCACTGAGGAGGG - Intronic
1043878546 8:85514863-85514885 GATTGAAATGCCACTAAGGAGGG + Intergenic
1044259472 8:90100792-90100814 GTTTTTAATGGCATTTAGAATGG + Intergenic
1046131982 8:109976469-109976491 GCTTGAAATTTCACTGAGGAAGG - Intergenic
1049899852 9:149059-149081 GTTTGAAGTGCCACTGGGGAAGG - Intronic
1053388502 9:37715490-37715512 GTTTAAAAGGGCACTGAAAAGGG - Intronic
1053742902 9:41159350-41159372 GTTTGAAGTGCCACTGGGGAAGG - Intronic
1054348178 9:63989174-63989196 GTTTGAATTGCCACTGGGGAAGG - Intergenic
1054445905 9:65315533-65315555 GTTTGAATTGCCACTGGGGAAGG - Intergenic
1054484365 9:65705977-65705999 GTTTGAATTGCCACTGGGGAAGG + Intronic
1054685441 9:68271950-68271972 GTTTGAAGTGCCACTGGGGAAGG + Intronic
1056970054 9:91194132-91194154 GTTGTAAATGGCACAGCGGCGGG - Intergenic
1060205826 9:121682313-121682335 GTTTGAAATGGCAGTGAAGGTGG - Intronic
1060879575 9:127108634-127108656 GGTTTTGAGGGCACTGAGGAGGG - Exonic
1061867920 9:133504608-133504630 GTTCTAACTGGTACTGAGGTCGG - Intergenic
1190989284 X:55528646-55528668 GTCTTGAATGGCTCTGAGGCCGG + Intergenic
1192245578 X:69369128-69369150 CTTTTACTTGGCCCTGAGGAGGG + Intergenic
1192826848 X:74705640-74705662 GCTCAAAAAGGCACTGAGGAGGG - Intergenic
1193581706 X:83272747-83272769 GTTTTTCATGGCAGTGAGGAGGG + Intergenic
1194422875 X:93698063-93698085 GTTTCAATAGGCAGTGAGGAAGG + Intronic
1194569095 X:95530983-95531005 ACTTTATATGGAACTGAGGAGGG + Intergenic
1196111555 X:111952181-111952203 GTTCTCAATGGCAATGAGCAGGG + Exonic
1196310133 X:114154317-114154339 GTTTTAAATGCCACTGGGATGGG - Intergenic
1196960583 X:120995911-120995933 GATTTAAATGGCAATGAATAAGG + Intergenic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1197800663 X:130344515-130344537 GTTTTAAAAGGCCAAGAGGAAGG + Intronic
1201451004 Y:14115340-14115362 GTTTTAAAAGACACTGACGCTGG + Intergenic