ID: 1164962555

View in Genome Browser
Species Human (GRCh38)
Location 19:32446839-32446861
Sequence CTGTCGGTTGAAGGTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164962555 Original CRISPR CTGTCGGTTGAAGGTGTTGT TGG (reversed) Intronic
907859367 1:58336293-58336315 CTGGCGTTTGAAGGTTTTCTGGG + Intronic
911707827 1:101035360-101035382 CAGTAGGTTGAAGGTGTTCAGGG + Intergenic
916246380 1:162692262-162692284 CTGTGGCTTGGAGCTGTTGTAGG - Intronic
917369354 1:174273387-174273409 CTGTGGGTTCATGGTCTTGTGGG + Intronic
917636339 1:176940502-176940524 CTGTCGGTTGAGAAAGTTGTAGG - Intronic
917805236 1:178607183-178607205 CTTTCTGTAGAAGGTGATGTTGG - Intergenic
918852594 1:189711151-189711173 CTGTGGATTGAGGGTGATGTTGG - Intergenic
920536620 1:206741513-206741535 CTCCGGGTTGTAGGTGTTGTGGG + Intergenic
921562936 1:216680100-216680122 CTGTAGGTTGTACGTGTTTTTGG + Intronic
923263645 1:232291451-232291473 CTGTGGGCTGTAGGTTTTGTGGG + Intergenic
1073546022 10:104349661-104349683 CTGTAGTTTGACGGTGTGGTAGG + Intergenic
1074709606 10:116166547-116166569 CGGCCGGGGGAAGGTGTTGTTGG - Intronic
1080222206 11:29919402-29919424 CTGTCGTTTGAAGGAATGGTTGG - Intergenic
1080965243 11:37206955-37206977 CTGTCAGTTTAAGGAGTTTTGGG + Intergenic
1081856848 11:46309302-46309324 CTGTCTGAGGAAGGCGTTGTTGG - Intronic
1083111787 11:60417190-60417212 CTCTGGATTGAAGGTCTTGTTGG - Exonic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094344751 12:29454855-29454877 CTGTCTGGTGAAGGTGTGGGTGG + Exonic
1095428118 12:42100802-42100824 CTGTCTGTTGAAAGTGTTCCTGG - Intronic
1099485019 12:83218744-83218766 CTTTCGGTTGGAAATGTTGTAGG - Intergenic
1104167329 12:126245847-126245869 ATGTCTGTTGTAGGTGTTATTGG + Intergenic
1108748514 13:53421048-53421070 CTATTGGTTGTAGGTGATGTTGG + Intergenic
1109370040 13:61411949-61411971 TTGTGGGTTGAAGCTGTTGATGG - Exonic
1114126915 14:19738969-19738991 CTGTCTTTTTAATGTGTTGTTGG + Intronic
1123859983 15:24455480-24455502 CTGTTGGTTTAAGATATTGTGGG - Intergenic
1128325499 15:66721398-66721420 CTGTTAGATGAGGGTGTTGTTGG - Intronic
1130200163 15:81818380-81818402 CTGTAGGATGATGGGGTTGTTGG + Intergenic
1133977554 16:10610596-10610618 CTGGGGGTTGAAGCTGTAGTGGG - Intergenic
1134220275 16:12348259-12348281 TTTTCGTTTGAAGCTGTTGTCGG + Intronic
1155916291 18:31560729-31560751 CTGTTGGTTGAGTGTGTGGTAGG - Intergenic
1156284149 18:35674522-35674544 CTGTAGGTAGAAGGTGCTGCAGG - Intronic
1157524452 18:48369870-48369892 CTATTGGTTGATGGTGTTGTTGG - Intronic
1159105212 18:63996713-63996735 CTGTCTGTTAATGGTGTAGTTGG - Intronic
1159582173 18:70245684-70245706 CTGTCGGTTGAGTGTGGGGTGGG - Intergenic
1160793940 19:935222-935244 CTGTCGGCTGCAGGTCTGGTGGG + Intronic
1163269472 19:16242511-16242533 CTGCTAGTTGAAGATGTTGTCGG + Intronic
1164962555 19:32446839-32446861 CTGTCGGTTGAAGGTGTTGTTGG - Intronic
925864112 2:8210615-8210637 GTTTAGGTTGAAGATGTTGTGGG - Intergenic
928112072 2:28518749-28518771 CTGTGGGTGGATGGTGTTGTGGG + Intronic
944863142 2:203834524-203834546 CTGTCAGTAGAAGGTGTTAGAGG - Intergenic
1169253443 20:4078834-4078856 CTGTTGTTTGATGGTATTGTTGG + Intergenic
1174510619 20:51049255-51049277 CTGTCAGTTGAAGCTGTGATGGG + Intergenic
1176342839 21:5714260-5714282 CTGTCTAATGAAGGTGTTTTAGG + Intergenic
1176475093 21:7146411-7146433 CTGTCTAATGAAGGTGTTTTAGG + Intergenic
1176501988 21:7610196-7610218 CTGTCTAATGAAGGTGTTTTAGG - Intergenic
1176537160 21:8112329-8112351 CTGTCTAATGAAGGTGTTTTAGG + Intergenic
1179396687 21:41046593-41046615 CTCTAGATTGAAGGAGTTGTTGG - Intergenic
951463594 3:22977498-22977520 CTGTCAGTAGAAGGTGTTAGAGG - Intergenic
968708714 4:2096547-2096569 CTGTCCTTTGAAGGTGCTCTCGG - Intronic
971014056 4:22469196-22469218 CTGTGGGTTGAGGGTGTCCTCGG - Intronic
978166998 4:105621521-105621543 CTGTTCTTTGAAGGTGTAGTAGG + Intronic
979099586 4:116598714-116598736 CTGTGGGGTGACGGTGGTGTAGG - Intergenic
984336428 4:178397837-178397859 CTCCCGGTTGAAGGGATTGTTGG - Intergenic
984869935 4:184316937-184316959 CGGTGGGGAGAAGGTGTTGTAGG - Intergenic
994386385 5:99137752-99137774 CTGTAGGTTCAATTTGTTGTTGG - Intergenic
997871126 5:137505910-137505932 CTGTGGTTTGAAGGTGATGTTGG + Intronic
999025740 5:148230280-148230302 CTATTTGTTGAAGGTGTTCTTGG - Intergenic
1007146617 6:39640877-39640899 GTGTAGGTAGAAAGTGTTGTTGG + Intronic
1008544658 6:52574549-52574571 CTGTAGGTTCAAGGTGCTATGGG + Intronic
1011151495 6:84278576-84278598 TTGTCGGTTGAAAGTGGAGTAGG - Intergenic
1015837116 6:137432470-137432492 CTGTGGGTAGAATGTGTTCTGGG - Intergenic
1016979707 6:149843177-149843199 CTTTCGGTTGAGGATGGTGTTGG - Intronic
1018124957 6:160673127-160673149 CTGTCGTCTGAGGGTGTTTTTGG - Intergenic
1019040279 6:169098202-169098224 GTGTTGGTTAAAAGTGTTGTTGG + Intergenic
1019763792 7:2834283-2834305 CTGGCCTTTGAAGGTTTTGTAGG - Intronic
1022267319 7:28770066-28770088 CTGTTGGAAGAAGTTGTTGTAGG - Intronic
1024068784 7:45768627-45768649 CTGGCTGGTGGAGGTGTTGTGGG + Intergenic
1039402629 8:37283493-37283515 CTATCGGTTTAAGGAGTTTTTGG - Intergenic
1042459816 8:69050971-69050993 CTGTTGGTTGATGGTATTGTTGG - Intergenic
1042941140 8:74109350-74109372 ATGTGGGTGGAAGGTTTTGTTGG - Intergenic
1043874124 8:85464829-85464851 CTGACGGTTAAAGGTGGGGTGGG + Intronic
1048658145 8:136566011-136566033 CTGTGGTCTGAAAGTGTTGTTGG - Intergenic
1052374704 9:27706014-27706036 CTGTTGGTTCAAGCTTTTGTTGG + Intergenic
1055497161 9:76867184-76867206 CGGGGGGTTGATGGTGTTGTGGG - Intronic
1056562299 9:87741988-87742010 CTGTGCGTTGAAGGGGTCGTGGG - Intergenic
1057020695 9:91695206-91695228 CTGTAGCTTGAATGTGGTGTTGG - Intronic
1060772529 9:126342926-126342948 CTGTCTGTTGTAGCTGCTGTAGG + Intronic
1203458428 Un_GL000220v1:11810-11832 CTGTCTAATGAAGGTGTTTTAGG + Intergenic
1186505491 X:10088592-10088614 CTGTCCTTTGAAGTTTTTGTTGG + Intronic
1186756003 X:12672188-12672210 CTGTCCGTGGAAGGTGATGTTGG + Intronic
1192914278 X:75636686-75636708 GTGTTGGTTGAAGGGGTTTTAGG + Intergenic
1200802942 Y:7402714-7402736 CTGTGGGTTGCAGGTGTAGTAGG + Intergenic