ID: 1164963143

View in Genome Browser
Species Human (GRCh38)
Location 19:32454255-32454277
Sequence TCCATTAATTCCTACACCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164963143_1164963146 -6 Left 1164963143 19:32454255-32454277 CCCGTGGTGTAGGAATTAATGGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1164963146 19:32454272-32454294 AATGGATAAAAGATGTAACAGGG 0: 1
1: 0
2: 2
3: 30
4: 445
1164963143_1164963147 -1 Left 1164963143 19:32454255-32454277 CCCGTGGTGTAGGAATTAATGGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1164963147 19:32454277-32454299 ATAAAAGATGTAACAGGGCCAGG 0: 1
1: 0
2: 9
3: 61
4: 614
1164963143_1164963148 4 Left 1164963143 19:32454255-32454277 CCCGTGGTGTAGGAATTAATGGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1164963148 19:32454282-32454304 AGATGTAACAGGGCCAGGCGTGG 0: 1
1: 0
2: 15
3: 96
4: 764
1164963143_1164963145 -7 Left 1164963143 19:32454255-32454277 CCCGTGGTGTAGGAATTAATGGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1164963145 19:32454271-32454293 TAATGGATAAAAGATGTAACAGG 0: 1
1: 0
2: 3
3: 16
4: 271
1164963143_1164963149 7 Left 1164963143 19:32454255-32454277 CCCGTGGTGTAGGAATTAATGGA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1164963149 19:32454285-32454307 TGTAACAGGGCCAGGCGTGGTGG 0: 1
1: 5
2: 78
3: 592
4: 3272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164963143 Original CRISPR TCCATTAATTCCTACACCAC GGG (reversed) Intronic
900645071 1:3705339-3705361 TCCCTAACTTCCTGCACCACAGG - Intronic
900919238 1:5660263-5660285 TCCTTTCTTTCCAACACCACAGG - Intergenic
902176060 1:14652006-14652028 TAAATTAATTCCTACAGAACAGG + Intronic
903980109 1:27179954-27179976 TCCATTAATTCCTGCAGGCCTGG - Intergenic
908211969 1:61909826-61909848 TCCATCAATGCCCCCACCACTGG - Intronic
1065483167 10:26214368-26214390 TCCATTAAATCCCACAGCTCTGG - Intergenic
1067365518 10:45624611-45624633 TCCATTCATTCCAACACCATGGG + Exonic
1069164928 10:65143101-65143123 TCCATTCATTCTGACAACACAGG + Intergenic
1072508604 10:96095375-96095397 TCCATTAATGGATATACCACCGG + Intergenic
1073578945 10:104646359-104646381 TCCCTTAAATCCAACACCACTGG - Intronic
1075908243 10:126101376-126101398 TTCTTAAATTCCAACACCACAGG - Intronic
1078748006 11:14133828-14133850 TTCATTATTTCCTACACATCGGG - Intronic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1086923244 11:92611719-92611741 CCCTATAATTCCTATACCACTGG - Intronic
1088231872 11:107681361-107681383 TCCATTGATTACTACTCCATTGG + Intergenic
1089219953 11:116862507-116862529 TCCATTCATTCATACAGAACAGG - Intronic
1094671583 12:32575432-32575454 TCCATTAGTTCCTCCAAGACTGG - Intronic
1097296743 12:57973470-57973492 TCCAGTATTTCCAATACCACTGG - Intergenic
1098327106 12:69314588-69314610 TCCATTTACTCCTACATCATTGG + Intergenic
1101638762 12:106569884-106569906 TCCATGAATACCTTCACCCCAGG - Intronic
1103242294 12:119423662-119423684 TCCCTTAATTCCTCCAGCCCTGG + Intronic
1105999832 13:25711303-25711325 TTCATTAATACCTACAGGACTGG - Intronic
1106954930 13:34926331-34926353 TCCATTAATTCTGACACCTAAGG + Intergenic
1111368061 13:87276378-87276400 TCTATTAATACCTCCAGCACTGG + Intergenic
1111932420 13:94525485-94525507 GCAAGTAATTCCTACACCAAGGG - Intergenic
1114071922 14:19117688-19117710 TCCATTAATTCTGACACCTAAGG + Intergenic
1114090336 14:19282276-19282298 TCCATTAATTCTGACACCTAAGG - Intergenic
1114512446 14:23274005-23274027 TCCATTAATCCCTAAACCATAGG + Exonic
1114761349 14:25318973-25318995 GCCATTAATGCCTACATCAAAGG - Intergenic
1120110301 14:80546415-80546437 TCACTTAATTCCTACACTTCTGG + Intronic
1120336450 14:83162997-83163019 TCCAGTAGTTTCTACCCCACAGG - Intergenic
1120827896 14:88971615-88971637 TCAATTATTCCCTTCACCACTGG - Intergenic
1122020260 14:98832036-98832058 TTCCTTAATGCCTACACCCCAGG - Intergenic
1131209072 15:90477780-90477802 TCCATAATTTCCTTCACGACTGG - Exonic
1157468476 18:47968908-47968930 CTCATTAATACCAACACCACAGG - Intergenic
1162164118 19:8740502-8740524 TCCATTTATACCCCCACCACAGG - Intergenic
1164963143 19:32454255-32454277 TCCATTAATTCCTACACCACGGG - Intronic
1166123832 19:40701881-40701903 GCCATTAATTGCTACACATCAGG + Intronic
925985438 2:9211308-9211330 TCCATTATTTCCAAAAGCACAGG - Intronic
926418187 2:12671310-12671332 TCAATTAAATCCTACTCCCCTGG - Intergenic
927423669 2:22957738-22957760 TCCATAGCCTCCTACACCACAGG + Intergenic
929083350 2:38143650-38143672 TCTATTAATTCCAACATCTCTGG + Intergenic
932991087 2:76788907-76788929 TCCTTTAATTCCCTAACCACTGG + Intronic
935113835 2:100116756-100116778 TTCATTCATTCCTGCACCTCTGG + Intronic
935898850 2:107768679-107768701 TCCATGAATTTCTACAACACTGG + Intergenic
937515495 2:122650436-122650458 AACATTACTTCCTACCCCACTGG - Intergenic
938486170 2:131711143-131711165 TCCATTAATTCTGACACCTAAGG + Intergenic
939994670 2:148908601-148908623 TCCAGTATTACCTACACCATGGG + Intronic
942064038 2:172253528-172253550 TCCATTTATTACTAAACCATGGG - Intergenic
943575035 2:189621622-189621644 GCTATTAATCGCTACACCACAGG + Intergenic
946992313 2:225348497-225348519 TCCACGAATTCCAACACCAGGGG + Intergenic
947658973 2:231852547-231852569 TCCATTGATGCCAACACCCCAGG - Intergenic
948664107 2:239523826-239523848 TCCTTTGATCCCTACACCCCAGG - Intergenic
1169947737 20:11007430-11007452 TCCCTAAAATCCTAGACCACCGG + Intergenic
1174640492 20:52039790-52039812 TCCATTAAATCCTAAAACAGTGG + Intergenic
1176164589 20:63665942-63665964 TCCACTAAGTCCCAGACCACAGG - Intronic
1177331340 21:19667603-19667625 ACCATTTATTTCTACAACACAGG - Intergenic
1180490364 22:15840043-15840065 TCCATTAATTCTGACACCTAAGG + Intergenic
1182680565 22:32076137-32076159 CCCATTAATTACAACCCCACTGG - Intronic
1183453203 22:37907456-37907478 TCCCTTCATTCCTAAAACACTGG + Intronic
951974050 3:28483211-28483233 TCCAGTTGTTCCTGCACCACTGG + Intronic
952132960 3:30385435-30385457 TGCTTTTATTCCTACAGCACAGG + Intergenic
954216296 3:49126300-49126322 TCCCTCAAGTCCCACACCACGGG + Intronic
954778596 3:53043020-53043042 CCCATGGATCCCTACACCACAGG + Intronic
962970326 3:140394908-140394930 TCCTTTAATTCCAGAACCACTGG + Intronic
964523527 3:157592564-157592586 TCCTTTAAATCCTACACCAAAGG - Intronic
965924486 3:173960191-173960213 TTCATTACTTCCTACAATACGGG + Intronic
966810662 3:183841232-183841254 TACATTAATTCCTGCTCCATAGG - Intronic
972160088 4:36214312-36214334 TCCATTGTTCCCTATACCACAGG + Intronic
976528111 4:86116933-86116955 AGCATTAATTCCTACAGCATAGG + Intronic
981390499 4:144184386-144184408 TCCATTAGATCCACCACCACAGG - Intergenic
981572588 4:146168571-146168593 TTCTTTCATTCCTAAACCACTGG - Intergenic
985314654 4:188643769-188643791 TCCATTAACTCCCATATCACAGG + Intergenic
990768080 5:59209994-59210016 TCCCATCACTCCTACACCACAGG + Intronic
991390180 5:66134453-66134475 GACATTAATGCCCACACCACAGG + Intergenic
991590613 5:68247784-68247806 TCCATTATTTCCTGCCCAACGGG + Intronic
993903808 5:93602409-93602431 TCCATTAATTATCACCCCACTGG + Intergenic
996445483 5:123544330-123544352 TCCCTTATTGCCTACACCACCGG + Intronic
998830870 5:146157407-146157429 CCCATTAATTCCTTAACAACAGG + Exonic
999510336 5:152243723-152243745 CCCAGTTATTCCTTCACCACTGG - Intergenic
999670079 5:153951924-153951946 CCCATGACTTCCTTCACCACAGG + Intergenic
1000826643 5:166053484-166053506 TCCATTAATTCAAACATCTCTGG - Intergenic
1004159536 6:13201236-13201258 TCCCTTAACTCCTACAACCCTGG - Intronic
1007065796 6:38989245-38989267 CCCATTATTTCCTTCCCCACTGG + Intronic
1008067003 6:47060838-47060860 ACAATTAATTCCTACCCCATAGG + Intergenic
1008427463 6:51376185-51376207 TCCATTAACCCCTCAACCACTGG + Intergenic
1009734276 6:67656345-67656367 TCCATTAATTCATTCAGCAAGGG - Intergenic
1011906628 6:92377930-92377952 TCCATAAATTCCCAATCCACAGG + Intergenic
1014256171 6:119161702-119161724 TCCATGATTTCCTGCTCCACTGG - Intergenic
1014857108 6:126416204-126416226 TCCATAAATCCCTAGAGCACAGG - Intergenic
1015788392 6:136941659-136941681 TCCAATAATTCCAACATGACTGG - Intergenic
1016232786 6:141826987-141827009 TTTATTAATTCCTCAACCACAGG + Intergenic
1018282795 6:162206134-162206156 GCCCTTATTTCCTACACCAAGGG + Intronic
1019074294 6:169374992-169375014 TTCATTAGTTCCCACAACACAGG - Intergenic
1019786621 7:2981212-2981234 TCCATTCATTCCCACAACTCTGG - Intronic
1021687420 7:23200706-23200728 TCCATTAAAGCCTCCACCTCTGG + Exonic
1027448371 7:78300994-78301016 AACATTAATTCCTACATTACAGG - Intronic
1028387246 7:90269995-90270017 TTTCTTAAGTCCTACACCACTGG - Intronic
1028910915 7:96206546-96206568 TCCATTAATTCCTATAAGTCCGG + Intronic
1034014944 7:147572333-147572355 TCCAGTGAGGCCTACACCACAGG + Intronic
1034460035 7:151193101-151193123 TCCCTTCATTCCCCCACCACAGG + Intronic
1042491521 8:69404278-69404300 TCCTACAAGTCCTACACCACAGG + Intergenic
1042662346 8:71168868-71168890 TCCCTTAAATCCTACATCAGTGG + Intergenic
1045471661 8:102518153-102518175 TCCTTGAATTCTTACAACACAGG - Intergenic
1045635032 8:104175234-104175256 TCATTTATTTCCTACACCTCAGG + Intronic
1048599787 8:135907376-135907398 TCCTTTAATACCCACAACACAGG - Intergenic
1055814734 9:80191415-80191437 TCATTTAATGCCTACATCACAGG + Intergenic
1060130532 9:121093526-121093548 TCCATTCATTCCTATTCTACAGG - Intronic
1186316722 X:8378487-8378509 AACAGAAATTCCTACACCACTGG - Intergenic
1188706276 X:33335809-33335831 TTCATTAATTGATACATCACAGG + Intronic
1189166246 X:38863940-38863962 TTCATGACTTCCTCCACCACTGG - Intergenic
1191794357 X:65004551-65004573 TCCATCAATACCTACACTATTGG - Intronic
1193253595 X:79321102-79321124 TCCATTCTTTCCTCCACCACAGG + Intergenic
1194847753 X:98832760-98832782 TCCATGAATCTGTACACCACAGG - Intergenic
1195770942 X:108350524-108350546 TCCACCAATTCCTACAACTCTGG - Intronic
1200546458 Y:4525061-4525083 TCCATTCATGCCTCCAACACTGG - Intergenic
1201573485 Y:15438168-15438190 TCCTTTCATTCCAACCCCACAGG + Intergenic
1201992662 Y:20044222-20044244 TGCATTATTTTCTACACCAAGGG - Intergenic