ID: 1164964745

View in Genome Browser
Species Human (GRCh38)
Location 19:32472561-32472583
Sequence CTCTTTCAGCAAAAGTCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164964745 Original CRISPR CTCTTTCAGCAAAAGTCAGG CGG Intronic
901658060 1:10781969-10781991 CTCTTTCTGGAAAAGGCTGGTGG - Intronic
903155735 1:21441073-21441095 CTCTAGCAGCAAAAGACAGAAGG - Intronic
903298486 1:22361248-22361270 CTGTTTTAACAAAAATCAGGAGG + Intergenic
903482909 1:23667465-23667487 CTATAGTAGCAAAAGTCAGGAGG + Intergenic
904596913 1:31652622-31652644 GTCTTTCATCCAAAGGCAGGTGG + Exonic
907543015 1:55233738-55233760 CTCTCCCAGCGAGAGTCAGGAGG - Intergenic
907985579 1:59526586-59526608 CTCTTCCAGGACAAGTTAGGAGG + Intronic
911867196 1:103043982-103044004 AGCTTTCAGGAAAAGTCTGGTGG + Intronic
912152708 1:106879828-106879850 CTCCTTAAGCAAAAGGAAGGAGG - Intergenic
913116021 1:115697739-115697761 CTCTGTCAGGTAAAGACAGGTGG - Exonic
913600384 1:120415969-120415991 CTCTAGCAGCAAAAGATAGGAGG - Intergenic
914086670 1:144460674-144460696 CTCTAGCAGCAAAAGATAGGAGG + Intronic
914192565 1:145424607-145424629 CTCTAGCAGCAAAAGATAGGAGG + Intergenic
914590476 1:149102560-149102582 CTCTAGCAGCAAAAGATAGGAGG + Intronic
917169626 1:172156624-172156646 CTCTTCCAGAAAAAAACAGGAGG - Intronic
917309427 1:173663192-173663214 CTCTCTCAGCACAAGCCTGGGGG + Intronic
919654492 1:200184306-200184328 CTGTTACAGCAACACTCAGGGGG - Intergenic
921027744 1:211303264-211303286 CTTTCTCACCAAAAGTAAGGAGG - Intronic
921223896 1:212997680-212997702 CTCTGTCATCAAAAGTCTAGAGG - Intronic
921333291 1:214062037-214062059 GTGTTTCAGCAACAGTAAGGAGG - Intergenic
922963273 1:229666184-229666206 CTAATCCAGCAAATGTCAGGAGG + Intergenic
923242010 1:232095356-232095378 ATCTTTTAGCAAATGTCAGTTGG + Intergenic
1068080890 10:52315532-52315554 CAGTTTCAGCAAAAATCAGAAGG - Intronic
1072552597 10:96490551-96490573 CTATTTGAGGAAAAGTCAGTTGG + Intronic
1073075534 10:100823882-100823904 CTCTATCAGCTAAAGCCTGGAGG - Intronic
1073330571 10:102667790-102667812 TTGTTTCAGGAAGAGTCAGGGGG + Intergenic
1074304956 10:112268441-112268463 ACATTTAAGCAAAAGTCAGGAGG + Intergenic
1075331353 10:121576477-121576499 CCCTTTCATCAAAAGGCATGTGG + Intronic
1076107667 10:127836082-127836104 CTCTTTTTGCAAAAGTTTGGAGG - Intergenic
1077353584 11:2104331-2104353 TTCATTCAGCAATGGTCAGGAGG - Intergenic
1079683565 11:23327875-23327897 GTCTTTCAGGACGAGTCAGGAGG - Intergenic
1080710545 11:34743075-34743097 CCATTTGACCAAAAGTCAGGAGG + Intergenic
1084419469 11:69053147-69053169 GGCCTTCAGGAAAAGTCAGGCGG - Intronic
1084604912 11:70166761-70166783 CCCTTTCCCCAAAAGGCAGGGGG - Intronic
1090214875 11:124953222-124953244 CTGGTTGAGAAAAAGTCAGGAGG - Intergenic
1094221148 12:27995001-27995023 ATCTTCCAGCAAAGGACAGGTGG + Intergenic
1095812736 12:46387743-46387765 CTCCATCAGCAAAAGTCAACTGG - Intergenic
1095926519 12:47584738-47584760 CTTTTACAGCAAAACTCAGAGGG - Intergenic
1096769921 12:53928453-53928475 CTCCTCCAGCAGAAATCAGGCGG - Intergenic
1096908711 12:54961177-54961199 CTTTGCCAGCAAAAGTCTGGTGG + Exonic
1097506420 12:60478463-60478485 TCCTTTCAGCAAACATCAGGGGG - Intergenic
1099793531 12:87365687-87365709 CTCTTTCAAGAATAGGCAGGTGG + Intergenic
1101328906 12:103741456-103741478 CTCTCTCAAAAAAAGTCAGTGGG - Intronic
1101554270 12:105793353-105793375 CTTTTTCAGCAAGAGTTAGAGGG + Intergenic
1102759405 12:115372537-115372559 GTCTGTTAGCAAAAGTCAGTGGG - Intergenic
1102763758 12:115413057-115413079 CTATTTCAGGAAAAGACAGCTGG + Intergenic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1103646237 12:122395289-122395311 CTCTTTCAGCAAAATAAAGAGGG + Intronic
1105073718 12:133255752-133255774 TTCTTTCAACAAAAGTAATGAGG + Intergenic
1106653726 13:31719698-31719720 CCCTTTCAGAAGAAGACAGGCGG + Intergenic
1108321948 13:49298308-49298330 CTGTGTCATCAAAAGGCAGGGGG - Intergenic
1110605336 13:77425740-77425762 CTTTATAAGCAGAAGTCAGGAGG + Intergenic
1112294400 13:98173918-98173940 CTGTTTCAGCAAAAGTCTGAGGG + Intronic
1112311016 13:98317628-98317650 CACTTACAGCAAAAGACAGAGGG - Intronic
1113640404 13:111953159-111953181 CTTTTTCTCCAAAAGTCAAGAGG + Intergenic
1116788308 14:49311947-49311969 CCCTGTAAGGAAAAGTCAGGTGG + Intergenic
1116931980 14:50699954-50699976 CTATTTCAAAAAAATTCAGGAGG - Intergenic
1117209024 14:53476345-53476367 ATCTTTCAGCCAAAGTCAGTGGG - Intergenic
1118814147 14:69298143-69298165 CTCTCTCAGGAAGAGTCAGGAGG + Intronic
1121854856 14:97258724-97258746 CACTTTCAGCAAAAATAATGAGG + Intergenic
1122684633 14:103495695-103495717 ATCTTTCTGCAAAAATCTGGGGG - Intronic
1122735769 14:103840248-103840270 CTTTCTCAGCAAAAGTGTGGTGG - Intronic
1124231109 15:27947213-27947235 GTTTTTCAGCAAAACTCAAGAGG + Intronic
1125126685 15:36231671-36231693 CTCTTTCTGCCAGATTCAGGAGG - Intergenic
1125867359 15:43064984-43065006 CTCATTCAGAAAACGTTAGGTGG - Intronic
1132201399 15:99956874-99956896 CGCTTTCAGCAAAAGCCTGCAGG - Intergenic
1132669939 16:1098406-1098428 CTTTTTCAGCACAAGGCGGGCGG + Intergenic
1134860229 16:17554288-17554310 CTCTCCCAGCAAGAGTCAGCAGG - Intergenic
1137775954 16:51054457-51054479 CTTTTACACCATAAGTCAGGTGG + Intergenic
1139913310 16:70412126-70412148 TTCTTTCAGCAAAGGTCTGTAGG + Intronic
1140695703 16:77531218-77531240 GTCTTTCAGCCAAAGTCTGTTGG - Intergenic
1141206845 16:81939341-81939363 CTCTTCCAGGAAAAGCCAGGAGG + Intronic
1144824949 17:18100560-18100582 CTCTTTCAGCCCAAGAAAGGTGG + Exonic
1145850834 17:28094428-28094450 CTCGGTCAGCAAAAGGCAAGTGG - Intronic
1146692165 17:34884003-34884025 ATATTTCAGCAAAAGTCATCTGG - Intergenic
1146968502 17:37053518-37053540 CTCTGTAGGGAAAAGTCAGGTGG + Intronic
1148541500 17:48484078-48484100 CTCTTTCAGCAAAACTGCTGTGG - Intergenic
1148669436 17:49399620-49399642 CTCTTTCAGCCAAACTTAGATGG + Intronic
1148811343 17:50293836-50293858 CACTTTCAGCAACAGACAGATGG + Intergenic
1149014660 17:51894185-51894207 CTTTCTCAGCAAAATTCTGGGGG + Intronic
1149660309 17:58331357-58331379 CTCTTGGAGCAGGAGTCAGGAGG - Intergenic
1149998512 17:61417364-61417386 CTCATTCTGCAAAGGGCAGGAGG + Intergenic
1150443574 17:65210958-65210980 CTTTTTCAGTAAGAGCCAGGGGG + Intronic
1152529207 17:80907173-80907195 CTCTTTCACCAACAATCAGGTGG + Intronic
1152582858 17:81175404-81175426 CTATTTCTGCAAAAGTCACTGGG - Intergenic
1153455409 18:5276086-5276108 CTCTCATAGCAAAAGGCAGGAGG - Intergenic
1158064481 18:53389165-53389187 CTTTCTCAGCAAAAGTTTGGAGG + Intronic
1158096573 18:53778818-53778840 CTCTTTCAGCAAAATATAAGTGG + Intergenic
1158971524 18:62672441-62672463 GTCTTTGAGCAAATGTAAGGTGG + Intergenic
1159038850 18:63303778-63303800 CTCAGTCACCGAAAGTCAGGAGG - Intronic
1159122637 18:64188555-64188577 CTCGGTCAGGAAATGTCAGGTGG - Intergenic
1160475534 18:79182338-79182360 CACTTTCAGTAACACTCAGGTGG + Intronic
1164004300 19:21134705-21134727 CTCATGGAGCAAAAGGCAGGAGG + Intergenic
1164964745 19:32472561-32472583 CTCTTTCAGCAAAAGTCAGGCGG + Intronic
927296182 2:21455729-21455751 ATCTCTCAGCAAAAGGGAGGAGG - Intergenic
927482506 2:23465444-23465466 CTCTATCAGCAAGAGGCAGGAGG + Intronic
927538553 2:23885507-23885529 CTCATCCAGCAAAAGTGAAGAGG + Intronic
927708116 2:25309502-25309524 CTCCTGCAGCAAAAGTCCAGGGG + Intronic
929741084 2:44601164-44601186 CTCTTTTAGAAAAAGTCATATGG + Intronic
930620774 2:53641433-53641455 CTCTGTCAGGAAAAGGGAGGGGG - Intronic
931861254 2:66356830-66356852 CAGTGTCAGCAACAGTCAGGTGG - Intergenic
936099736 2:109565615-109565637 CTATTTTAGCCAAAGTCTGGAGG - Intronic
937668676 2:124515987-124516009 CTCTATCAGAAAGAGACAGGAGG + Intronic
939204649 2:139085128-139085150 CACTTTCAGCCAAGGTCAGATGG - Intergenic
942869240 2:180715060-180715082 CTCTTTCAGAAAATGTCACTTGG - Intergenic
945462969 2:210132546-210132568 TTCTTTTAGCAAAAGTTAAGTGG - Intronic
945959629 2:216119094-216119116 CCGATTCAGCAAAAGTCAGCTGG + Exonic
947202914 2:227631242-227631264 CTCTTTCTTCAAAAGGCAGGGGG - Intronic
947689220 2:232119413-232119435 CTCTTTCAGAAAAATTCAGATGG + Intronic
948728347 2:239948082-239948104 CTGTTTGAGCAAAAGTCCAGAGG + Intronic
1169991044 20:11502903-11502925 CTCCTTGAGCAAAAGTCAAAAGG + Intergenic
1170035775 20:11988127-11988149 CTGATTCAGCAAATGTGAGGTGG + Intergenic
1170472729 20:16684379-16684401 GTCTTTCAACACAAGGCAGGTGG + Intergenic
1170892824 20:20390632-20390654 CCCTTTCAGCAAAATTGCGGAGG - Intronic
1172232371 20:33345593-33345615 CTCTGTCATCAACAGTCTGGCGG + Intergenic
1172930933 20:38586085-38586107 CCCTTCCAGCAAAACTCAGCTGG - Exonic
1173164601 20:40678140-40678162 CTCTTCCAGAAACAGTAAGGTGG + Intergenic
1173725066 20:45291560-45291582 CTCTTTCTGCAACAGTCAGGTGG + Intergenic
1173928864 20:46801547-46801569 GTCTTTCAGGGAAAGTCAGATGG + Intergenic
1179363714 21:40736362-40736384 TTCTCTCTCCAAAAGTCAGGGGG + Intronic
1182974158 22:34606845-34606867 CTCTTTCTTCTAAACTCAGGAGG + Intergenic
1183387209 22:37521705-37521727 CCCTGTCTGCAAAAGGCAGGCGG + Intergenic
1183615918 22:38945289-38945311 CTCTTTCAGCAAAACTTCAGAGG - Intergenic
1184181796 22:42833437-42833459 CTTTTACAGAAAAAGTCTGGAGG - Intronic
1185071809 22:48660773-48660795 TTCTGTCAGCAGAAGTGAGGAGG + Intronic
951121804 3:18937092-18937114 CTATTTCAAAAAAAGTCAAGCGG + Intergenic
951508405 3:23474979-23475001 CACTTTCAGCAAAATGCAGTTGG - Intronic
951589209 3:24245003-24245025 CTGTTTGAACAAAGGTCAGGGGG + Intronic
953773050 3:45793437-45793459 CTCTTTTTGAAAAAGTCAGCAGG - Intronic
956304414 3:67808374-67808396 TCCTTTCTGCAAAACTCAGGAGG - Intergenic
956458909 3:69451855-69451877 CTCTTTTGACAAAAGACAGGTGG + Intronic
957840046 3:85655945-85655967 CTTTTGGAGCAAAATTCAGGAGG - Intronic
959893895 3:111585645-111585667 CTCTTTTATAAAAATTCAGGTGG + Intronic
960690371 3:120341060-120341082 ATCTTGCAGCAAAAGTCAACTGG + Intronic
960868750 3:122228739-122228761 CTCTTACAGCAAATGTAATGGGG - Intronic
962415846 3:135181217-135181239 TTCTTTCAGCATAAGTGTGGTGG + Intronic
962829711 3:139129263-139129285 CTCTGTTACCCAAAGTCAGGTGG - Intronic
962991448 3:140581032-140581054 CTCAGTCATGAAAAGTCAGGAGG - Intergenic
963810812 3:149774541-149774563 CTCATTCAGCAGTAGGCAGGAGG - Intronic
964479447 3:157127371-157127393 CTCATTAAGTAAAAATCAGGGGG + Intergenic
964751732 3:160059904-160059926 CAGTTTCAGAGAAAGTCAGGTGG + Intergenic
966938366 3:184729507-184729529 TTCTTTCAGCAAAATTTATGGGG - Intergenic
966960419 3:184931409-184931431 TTCTTATAGCAAGAGTCAGGTGG + Intronic
968531469 4:1094179-1094201 CTCTTTCCCCACAAGGCAGGTGG + Intronic
971330092 4:25674848-25674870 TTGTTTCAGCAAAAGTGGGGTGG + Intronic
976487082 4:85620194-85620216 CTCTTTCAGAAAAACTGAAGAGG - Intronic
977916530 4:102600506-102600528 GTGTGTCAGGAAAAGTCAGGGGG + Intronic
978828820 4:113057769-113057791 CTCTTTCAGGTAAAGGCAGAAGG - Intronic
980727268 4:136779132-136779154 CTCTTTCAGGAAAATAGAGGAGG - Intergenic
981456030 4:144954199-144954221 CTCTGTGAGCAACAGTGAGGAGG - Intergenic
982108542 4:152032402-152032424 AGCTTTCATCAAAATTCAGGGGG + Intergenic
982244806 4:153341025-153341047 CTCTTTTAGCACAAGCCTGGGGG - Intergenic
987455425 5:18138703-18138725 CTCTCTCATCAAAAGACTGGAGG - Intergenic
987869580 5:23597851-23597873 TTCATTCAAAAAAAGTCAGGAGG + Intergenic
989413530 5:41147618-41147640 TTCTTTTTGCAAAAGTAAGGTGG + Intronic
989496146 5:42113232-42113254 CTCTTACAGAAAAGGTCAAGTGG - Intergenic
989999632 5:50877847-50877869 GTCTATCAGCAAGAGTCAGAGGG - Intergenic
990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG + Intergenic
991234830 5:64381516-64381538 CTCTTTCAACAGAAGTTAGCTGG + Intergenic
991443306 5:66674315-66674337 CTCTTACAGCAAACAGCAGGTGG - Intronic
991608436 5:68426411-68426433 CTCGCTCAGCTATAGTCAGGTGG + Intergenic
994647997 5:102493107-102493129 CTCTTTCAGAAAAAATGAGGAGG + Intronic
994837332 5:104872345-104872367 CTCTTTCAGCAAAAATCTGGGGG + Intergenic
996238563 5:121166051-121166073 CTGATTCAGCAAAGGTCAAGAGG + Intergenic
997997248 5:138596677-138596699 CTCTTGATGAAAAAGTCAGGAGG + Intergenic
998533537 5:142907775-142907797 CCATTTGACCAAAAGTCAGGAGG + Exonic
998848384 5:146332665-146332687 TTCTTTCAGCAAGAATCATGTGG + Intronic
999291344 5:150428402-150428424 CTTTCACAGCAAGAGTCAGGAGG - Intergenic
1000147365 5:158466545-158466567 CTCTTTCAGGCAAATGCAGGTGG + Intergenic
1000161482 5:158601798-158601820 CTCTTTCAGCAATAGTCCTCTGG + Intergenic
1001628233 5:173154857-173154879 CTCAGTCAGCAATAGTCAAGTGG + Intronic
1002336987 5:178486579-178486601 CTCTTTCAGGAAGAGACAGTTGG + Intronic
1002935056 6:1664374-1664396 CTCTGTCACCAACAGTGAGGTGG + Intronic
1006337232 6:33427082-33427104 CTCTGTGAGGCAAAGTCAGGTGG + Intronic
1007053084 6:38852868-38852890 CTCTTACAGAAAAAAACAGGAGG + Intronic
1008662856 6:53686804-53686826 CTCTTACAGCACAGGTGAGGTGG + Intergenic
1009840101 6:69060268-69060290 CTCTCTCAGCAAAAGCCATAGGG + Intronic
1009969733 6:70614171-70614193 CTCTTTCAAAAAAAGAAAGGAGG - Intergenic
1013853588 6:114544107-114544129 CCCTTACAGCCAAAGACAGGGGG + Intergenic
1015129783 6:129796213-129796235 CTCTTTCAGCAGAAGAGTGGGGG - Intergenic
1017507469 6:155081812-155081834 CTCCTTAAGAGAAAGTCAGGGGG - Intronic
1020735696 7:11946559-11946581 CTCTTCCAACAAAAGTGAGGAGG - Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021874640 7:25037134-25037156 CTCTTTGAACAAAAGACAGATGG - Intergenic
1022421857 7:30230768-30230790 CTCTTTCTGTAAAATACAGGTGG + Intergenic
1023619818 7:42059050-42059072 CTCTTTAAACAAAAGTTAGTGGG - Intronic
1024163801 7:46709260-46709282 CCCTTTCAGCAGAAGACAGGTGG - Intronic
1026933226 7:74236710-74236732 ATTTGTCAGCCAAAGTCAGGAGG - Intronic
1028882714 7:95898070-95898092 TGCCTTCAGCAATAGTCAGGTGG + Intronic
1030056707 7:105589573-105589595 CTCTCTCAGCACAACTCAGATGG + Intronic
1031743113 7:125459249-125459271 CTCTTTCAGCTCAAGTCTGCTGG + Intergenic
1032908976 7:136407335-136407357 CTCCTCCAACAAAAGTAAGGTGG - Intergenic
1034728649 7:153364491-153364513 CTATTTCAACAAATGTCAAGAGG - Intergenic
1036184108 8:6609536-6609558 CGCCTTCAGCGAAAGTCAGGGGG + Intronic
1037314728 8:17590265-17590287 CTCTTTCAGCAAATGTTGGTAGG - Intronic
1037656696 8:20889681-20889703 CTCATTCTTCTAAAGTCAGGAGG + Intergenic
1042732669 8:71954593-71954615 CTCTTTCAGCACAAGAGAGAAGG - Intronic
1047067843 8:121306450-121306472 CTGTTTCTGCAAAAGTAAGAGGG - Intergenic
1047819155 8:128499715-128499737 CTCTTTTAGCAAAAGTCATAGGG + Intergenic
1050196491 9:3089561-3089583 CCCTTTCTGCAAGAGTCAGTTGG + Intergenic
1050456263 9:5837465-5837487 CTCTTTAATCAAAAGACAAGTGG + Intergenic
1050498602 9:6270418-6270440 CTCTTTCAGAAAAACTGAAGAGG + Intergenic
1052031649 9:23636036-23636058 CTATTACAGCAAAAGATAGGAGG - Intergenic
1055222934 9:73959822-73959844 CTATTTCAGCAAAAGTTTGTTGG + Intergenic
1058320680 9:103626900-103626922 CCTTTTGAGCACAAGTCAGGAGG - Intergenic
1058653571 9:107199340-107199362 CTCTTTCACTAACAGGCAGGTGG + Intergenic
1062074320 9:134576147-134576169 CTCTGTCAGCAACTCTCAGGAGG + Intergenic
1185592239 X:1285239-1285261 CTTTTTCAGAAACAGCCAGGGGG + Intronic
1192781636 X:74299108-74299130 CTCTTACAACAAAATTCAGTTGG + Intergenic
1196066901 X:111473727-111473749 TTCTTCTAGCAAAAGTCAGTTGG - Intergenic
1197931899 X:131704723-131704745 CCCTTGGAGCAAAAGTCAGTAGG + Intergenic
1199449322 X:147961855-147961877 CTCTGTCAGCAAAGGTCTTGGGG + Intergenic
1199508106 X:148589098-148589120 CTCTTTCAGCATAAGGAGGGAGG + Intronic
1200002083 X:153067335-153067357 CTCTTTCCACAAAAGGCAAGAGG + Intergenic
1200005650 X:153082690-153082712 CTCTTTCCACAAAAGGCAAGAGG - Intergenic
1201147883 Y:11075371-11075393 CTCTTACAGCAGAATTCAAGGGG + Intergenic
1201350257 Y:13032158-13032180 CTCTTTCATCATAAATCAGCTGG + Intergenic
1202605368 Y:26635217-26635239 CTCACTCAGGAAAAGGCAGGAGG + Intergenic