ID: 1164965443

View in Genome Browser
Species Human (GRCh38)
Location 19:32479295-32479317
Sequence CCCCTGATGAACCTGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164965443_1164965448 -1 Left 1164965443 19:32479295-32479317 CCAGGCACCAGGTTCATCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1164965448 19:32479317-32479339 GTGGCCTCTACTGCTTGGACTGG 0: 1
1: 0
2: 0
3: 4
4: 97
1164965443_1164965447 -6 Left 1164965443 19:32479295-32479317 CCAGGCACCAGGTTCATCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1164965447 19:32479312-32479334 CAGGGGTGGCCTCTACTGCTTGG 0: 1
1: 0
2: 0
3: 19
4: 173
1164965443_1164965450 18 Left 1164965443 19:32479295-32479317 CCAGGCACCAGGTTCATCAGGGG 0: 1
1: 0
2: 1
3: 14
4: 128
Right 1164965450 19:32479336-32479358 CTGGAGACTGCAGAAAAGACAGG 0: 1
1: 0
2: 3
3: 74
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164965443 Original CRISPR CCCCTGATGAACCTGGTGCC TGG (reversed) Intronic
900723297 1:4194732-4194754 CCCCTGCAGGAACTGGTGCCAGG - Intergenic
900886595 1:5419735-5419757 ACCCTCATTTACCTGGTGCCAGG + Intergenic
903360026 1:22771291-22771313 TCCCTGATGACCCTGGTGCTGGG - Intronic
904296314 1:29521825-29521847 CCCCTGATGAGCCTGGGCCCTGG + Intergenic
904384371 1:30131868-30131890 CCCCTGCTGAGCCTGGAGGCAGG + Intergenic
904410012 1:30319620-30319642 CCCCTGATGAGCCTGGGCCCTGG - Intergenic
904990685 1:34590320-34590342 CCCCTGTTGGAGCAGGTGCCTGG - Intergenic
907328840 1:53658368-53658390 ACCCTGTTGAACTTTGTGCCAGG - Intronic
922156008 1:223040128-223040150 CCCCTGATGAGCCTCCTGGCTGG + Intergenic
1062925923 10:1315234-1315256 CACCTGCAGCACCTGGTGCCTGG - Intronic
1062968470 10:1628118-1628140 CCCCTCAGGCACCTGCTGCCAGG - Intronic
1063049928 10:2435549-2435571 CCCATGATGAACCTGAGGCTGGG - Intergenic
1064157463 10:12915908-12915930 ACCCTGCAGACCCTGGTGCCAGG - Intronic
1064678667 10:17787144-17787166 CCCCTGACGCTACTGGTGCCTGG + Intronic
1065234749 10:23637706-23637728 CACCTGATGTATCTGCTGCCTGG + Intergenic
1067057829 10:43062592-43062614 CCCCTCATGCAACTGGTGGCTGG - Intergenic
1067685748 10:48465278-48465300 CTCTTGATGAACTTGCTGCCAGG + Intronic
1068791040 10:61031587-61031609 CCCATGAGGAAGCTGGTGCATGG - Intergenic
1069635834 10:69924240-69924262 CTCCTGATGAACCTGCTCACGGG - Intronic
1070650619 10:78233004-78233026 TCCCTGCTGAACATGGTGGCTGG + Intergenic
1071296334 10:84222809-84222831 CCTCTTATGAACCTCGTACCTGG + Exonic
1073061094 10:100734417-100734439 GGCCTGGTGAACCTGCTGCCTGG + Intergenic
1073501101 10:103937857-103937879 CTCCTGGTGAGCCTGGTGTCAGG + Intergenic
1074113749 10:110440552-110440574 CTCCCGTTGAACCTGCTGCCAGG + Intergenic
1076474407 10:130742450-130742472 CCCCTGCTGAACATGGGGCGGGG - Intergenic
1077526385 11:3068094-3068116 CCTCTGATGAAAATGCTGCCTGG - Intergenic
1078071428 11:8113846-8113868 GCTAGGATGAACCTGGTGCCCGG - Intronic
1078354894 11:10626119-10626141 GCCCTGAAGAACCTGGCCCCCGG - Exonic
1078397069 11:10990674-10990696 CCACTGTCGATCCTGGTGCCTGG - Intergenic
1079320628 11:19448542-19448564 CCCATGAAGAACCACGTGCCAGG - Intronic
1081847594 11:46251961-46251983 CCCCTGCTGAACCTGGGTCCTGG + Intergenic
1083340504 11:61955783-61955805 CGCCTCATGAGCCTGGTGTCGGG + Exonic
1084692243 11:70734170-70734192 CCCCTGCCGCACCTGCTGCCCGG - Intronic
1084967820 11:72753548-72753570 CCCCATATGAACTTGGGGCCCGG - Intronic
1087381591 11:97409981-97410003 ACCCTGATGACCCAGGTGCCAGG + Intergenic
1091333733 11:134751374-134751396 CCACTCATGTGCCTGGTGCCTGG + Intergenic
1094261503 12:28505606-28505628 CTCCTAATGATCCTGATGCCAGG + Intronic
1097032701 12:56101132-56101154 CCTCTGATGACTCTGATGCCAGG - Exonic
1103733885 12:123046222-123046244 CCCCTCCTGAAAATGGTGCCAGG + Intronic
1105584374 13:21730456-21730478 CCCCAGAGTAACCTGGAGCCTGG + Intergenic
1106455926 13:29926753-29926775 CCTCTGATGAACCTGATGCCAGG + Intergenic
1106559266 13:30834376-30834398 ACCCTCATCAACCTGGGGCCTGG + Intergenic
1106560970 13:30845848-30845870 CCCCTAATGACCCTAGGGCCAGG - Intergenic
1108832860 13:54500439-54500461 CCCCAGAAGACCCTGGTGCCAGG + Intergenic
1117452706 14:55866098-55866120 CCCCTCATGAACCTACTACCAGG - Intergenic
1121023877 14:90600208-90600230 CCCCTCATCTCCCTGGTGCCCGG + Intronic
1122937553 14:104967059-104967081 CCCCAGCTGCACCTGCTGCCAGG - Intronic
1122938473 14:104970641-104970663 CCCCTGATGGGCCAGGAGCCTGG + Intronic
1123111337 14:105868335-105868357 CCCCTCACCAACCTGGAGCCTGG - Intergenic
1127711291 15:61601004-61601026 CCCCTGATGATGGTGGTTCCCGG + Intergenic
1127930133 15:63590295-63590317 CCCCTGATGACCACGGTGTCAGG + Intronic
1129600767 15:76996823-76996845 GCCCTGAGCATCCTGGTGCCTGG - Intronic
1130933556 15:88449778-88449800 CCCTTCATGAACCTGGTCCCTGG + Intergenic
1132575887 16:663842-663864 CCCCTGCTGGACCAGGTTCCTGG + Intronic
1132736186 16:1387273-1387295 CCCATGGTGAGCCTGGTGACAGG + Intronic
1134631914 16:15762504-15762526 CAGCTGATCCACCTGGTGCCAGG - Intronic
1135632684 16:24048411-24048433 CCACTGATGTACTTAGTGCCAGG - Intronic
1135970200 16:27066801-27066823 CCACTGATGTCACTGGTGCCAGG + Intergenic
1139911130 16:70398373-70398395 CACCGGGTGAAGCTGGTGCCCGG - Exonic
1139958857 16:70706254-70706276 CCTCTGAGGGACCTGGAGCCAGG - Intronic
1144673123 17:17144086-17144108 CCCATGGAGAACCTGGTGCAAGG - Intronic
1145937067 17:28720605-28720627 CCACTGATGCACCTGTGGCCAGG + Intronic
1150120739 17:62599572-62599594 CCCCTGATGACCCTGGGTTCTGG + Intronic
1152294020 17:79456317-79456339 CCCCAGATGTCCATGGTGCCTGG - Intronic
1152699498 17:81812025-81812047 CCGGGGATGAGCCTGGTGCCTGG + Intronic
1154083956 18:11283777-11283799 CCCCTGTGGACCCTGGTGACAGG + Intergenic
1160010565 18:75104554-75104576 CGCCTGCTCAACCCGGTGCCTGG + Intergenic
1160574299 18:79842034-79842056 CCCCTGCAGACCCAGGTGCCAGG + Intergenic
1160773437 19:843900-843922 CGCCTGGTGAACGTGGTGCTCGG + Exonic
1161411551 19:4120991-4121013 CCCCTCAAGAACCAGGTGTCAGG - Intronic
1162017699 19:7854409-7854431 CCCCTGAAGAGCATGGAGCCAGG - Intronic
1164965443 19:32479295-32479317 CCCCTGATGAACCTGGTGCCTGG - Intronic
1165123851 19:33580541-33580563 CCCCTGGCGAGCCAGGTGCCAGG - Intergenic
926353868 2:12022079-12022101 CTCCTGAAGGACCTGGTGCAGGG + Intergenic
926707237 2:15845511-15845533 CTCCTGATGAGCCTGCTCCCTGG - Intergenic
927211699 2:20642704-20642726 CCCCTGATGGACGTGGGCCCTGG - Intronic
929452922 2:42048455-42048477 CGCCTGATGGACCTGGCTCCGGG + Exonic
929866026 2:45717968-45717990 CCCCTCAAGAAGCTGGTGGCTGG + Intronic
932327180 2:70871117-70871139 CTCCTGATCCTCCTGGTGCCAGG + Intergenic
932459410 2:71872713-71872735 CCCCTGGGGAAGCTGGGGCCTGG + Intergenic
933194376 2:79371847-79371869 CTCCTGGTGATCCTGGTGCTAGG + Intronic
938768355 2:134479055-134479077 CCATTGATGAACCTGGAGGCAGG + Intronic
947624049 2:231608357-231608379 TCCCTGATGAACCTCCTGCCTGG + Intergenic
1172006989 20:31824433-31824455 GCGCTGCTGAACCTGGGGCCTGG + Intronic
1173720403 20:45253229-45253251 CCCCTGCTGAAGCTGGAGCAGGG - Intronic
1174008422 20:47428849-47428871 CCACTGATGTACCCAGTGCCTGG + Intergenic
1176900767 21:14439167-14439189 CCCATGATGACACTGGTGCCAGG - Intergenic
1182318502 22:29463561-29463583 GCCCTGATGTCCCAGGTGCCTGG + Intergenic
1183093944 22:35541181-35541203 CTCCTGCTGAGCCAGGTGCCCGG - Exonic
1183485786 22:38087105-38087127 CCCCTGATGACTCAGGTACCTGG + Exonic
1185261465 22:49867342-49867364 CCCCTGAAGAAGCGTGTGCCAGG + Intronic
949585273 3:5431072-5431094 CCCCTAAGGAACCTGGAGCCTGG + Intergenic
954463593 3:50641543-50641565 CCCTTGTAGAACCTGGTGCATGG - Intronic
956173702 3:66453857-66453879 CGCCTGATGAGCCTGGTCTCAGG + Intronic
956650290 3:71498740-71498762 CCCCTGGAGATCCTGGTGCTTGG - Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961441259 3:126954670-126954692 GCCCTGGTGAGCCTGGTTCCTGG - Intronic
961662247 3:128475572-128475594 CCCCTGACCACCCTGGTACCAGG + Intergenic
964879174 3:161404748-161404770 CCACTGCTGAACCTGGAACCAGG + Intergenic
966010042 3:175064050-175064072 CCTGGGATGAACCTGGTTCCTGG - Intronic
969424471 4:7116123-7116145 CCCGTGATGACCCTGGAGCTCGG - Intergenic
972789335 4:42355952-42355974 CCCCTGATGAAGCTGGGGCAGGG - Intergenic
974750035 4:66127771-66127793 CCTCTGCTTAAACTGGTGCCAGG + Intergenic
975221861 4:71821715-71821737 CACCTGATGTTCCTGGTGCCAGG + Intergenic
975673272 4:76802715-76802737 CCCCTGATGGACATGAGGCCAGG + Intergenic
979267946 4:118725342-118725364 CTCCTGATGAACCTGAAGTCAGG + Intronic
979940742 4:126758990-126759012 CCTGTGATGGACCTGGTGCTGGG + Intergenic
983853782 4:172616787-172616809 CCACTGAGGGACGTGGTGCCTGG - Intronic
985559291 5:574357-574379 CCTCTGATGAAAGTGGAGCCCGG - Intergenic
986736716 5:10673765-10673787 CCCCTGATGGAGCCAGTGCCTGG - Intergenic
988470144 5:31530314-31530336 CTCATGATAAACCTGGGGCCCGG + Intronic
988503022 5:31799215-31799237 CCTCTGATGATGCTGGTGTCTGG + Exonic
989658396 5:43770540-43770562 CAACTGATAAACATGGTGCCAGG + Intergenic
990751524 5:59021945-59021967 CCCCTGAAGGACCGGCTGCCTGG - Intronic
990774683 5:59292793-59292815 CCCCTGAGGAATGTAGTGCCTGG + Intronic
998203784 5:140145345-140145367 CCCCTGAGGCTCCTGCTGCCAGG + Intergenic
999270293 5:150292968-150292990 CCTCTGAGGGACCTGATGCCAGG - Intergenic
1001422146 5:171596289-171596311 CGTCTGATGAACCTGCTGCAAGG - Intergenic
1002409234 5:179060930-179060952 CCCCAGATGTAACTGGGGCCTGG + Intronic
1002469580 5:179427507-179427529 CCCGTGTTGAACCTGGCTCCCGG + Intergenic
1003116109 6:3284806-3284828 CCTGTGCTGAGCCTGGTGCCAGG + Intronic
1003794178 6:9581547-9581569 CCCCAGCTCCACCTGGTGCCTGG - Intergenic
1004159741 6:13202907-13202929 CCCCTCATGCACATGGTGCAAGG - Intronic
1006081524 6:31570346-31570368 CCCCTCAGGGACCTTGTGCCTGG + Intergenic
1006535370 6:34695645-34695667 CCCCAGATGAACCCTCTGCCAGG + Intronic
1011635609 6:89369995-89370017 CTCCTGGTGTGCCTGGTGCCTGG - Intronic
1018921504 6:168179164-168179186 CCCCTGCAGTACCTGGTTCCGGG + Intergenic
1023566508 7:41528427-41528449 CCCCTGAGGAACCAGAGGCCAGG - Intergenic
1026866170 7:73825280-73825302 CTCCTGTTCAGCCTGGTGCCAGG + Intronic
1028673460 7:93431333-93431355 CCGCTGTTGGACATGGTGCCAGG - Intronic
1029252178 7:99244767-99244789 CCCCGGCTGAACCTAGAGCCTGG + Intergenic
1037755094 8:21705296-21705318 CCCCTGCTGAACATGGTCCCTGG - Intronic
1044299473 8:90567046-90567068 CCCATGAAGACCCTGGTACCTGG + Intergenic
1049066596 8:140321259-140321281 ACCCTGAGGAGCCAGGTGCCAGG + Intronic
1050048745 9:1576036-1576058 CCCCTGTGGACCCAGGTGCCAGG - Intergenic
1061042443 9:128148050-128148072 CCCCTCATGACCCTGTTCCCAGG - Intergenic
1062225915 9:135450306-135450328 ATCCAGATGAACGTGGTGCCTGG + Intergenic
1062273378 9:135719794-135719816 TCCCAGGTGACCCTGGTGCCTGG - Intronic
1185554162 X:1007286-1007308 ACCCTTTTGAATCTGGTGCCCGG - Intergenic
1192151036 X:68712605-68712627 CCCCAGATGATCCTGGTTCCTGG + Intronic
1192324362 X:70119690-70119712 GCCCTGAAGAACCAGATGCCAGG + Intergenic
1195583328 X:106532805-106532827 ACCCTGACCAATCTGGTGCCTGG + Intergenic
1196768758 X:119272918-119272940 CCCCTGATGACCCTCGTCCTTGG - Intergenic
1198174623 X:134143237-134143259 CCATTGCTGAACATGGTGCCTGG - Intergenic