ID: 1164973993

View in Genome Browser
Species Human (GRCh38)
Location 19:32557729-32557751
Sequence ACTTGAATGGTTCACTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164973993_1164973997 30 Left 1164973993 19:32557729-32557751 CCTGTGTAGTGAACCATTCAAGT No data
Right 1164973997 19:32557782-32557804 TTTATAACTTTATAAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164973993 Original CRISPR ACTTGAATGGTTCACTACAC AGG (reversed) Intergenic
No off target data available for this crispr