ID: 1164976987

View in Genome Browser
Species Human (GRCh38)
Location 19:32581035-32581057
Sequence GATCCCGGAGGCCCCGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 265}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164976977_1164976987 13 Left 1164976977 19:32580999-32581021 CCTGCACGCAGAGGCGCCGATCA 0: 1
1: 0
2: 1
3: 1
4: 49
Right 1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 265
1164976975_1164976987 20 Left 1164976975 19:32580992-32581014 CCAAGTCCCTGCACGCAGAGGCG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 265
1164976972_1164976987 30 Left 1164976972 19:32580982-32581004 CCAGCGCAGCCCAAGTCCCTGCA 0: 1
1: 0
2: 3
3: 30
4: 358
Right 1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 265
1164976976_1164976987 14 Left 1164976976 19:32580998-32581020 CCCTGCACGCAGAGGCGCCGATC 0: 1
1: 0
2: 0
3: 2
4: 22
Right 1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 265
1164976984_1164976987 -3 Left 1164976984 19:32581015-32581037 CCGATCACGGGTGGGAGGTGGAT 0: 1
1: 0
2: 1
3: 6
4: 105
Right 1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 265
1164976974_1164976987 21 Left 1164976974 19:32580991-32581013 CCCAAGTCCCTGCACGCAGAGGC 0: 1
1: 0
2: 0
3: 21
4: 152
Right 1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG 0: 1
1: 0
2: 3
3: 29
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164976987 Original CRISPR GATCCCGGAGGCCCCGCCCC AGG Intergenic
900102301 1:967041-967063 GTCCCGGGAGGCCCCGCCCGCGG - Intronic
900265286 1:1754144-1754166 GATCATGGAGGCCCCGGCCGCGG + Exonic
900269312 1:1778850-1778872 GGTCCGGGAGGTCCCGCCCGCGG - Intronic
900412926 1:2521133-2521155 GAACTTGTAGGCCCCGCCCCCGG + Exonic
900735799 1:4298720-4298742 GATCTTGGAGGCCCAGTCCCAGG - Intergenic
901742542 1:11351792-11351814 GATCCAGGGGGCTCCGCTCCAGG + Intergenic
901931086 1:12596326-12596348 GACCCCGGAGGCCCAGCCCTCGG - Intronic
903159039 1:21471707-21471729 GTTCTCGGAGGTCCCGTCCCTGG - Exonic
903558526 1:24210740-24210762 GACTCCGGAGGCCCCATCCCAGG - Intergenic
903832574 1:26183809-26183831 GATACCGGAGACCCCCCCACAGG + Exonic
903860084 1:26359941-26359963 GATCTCGGAGGCCACATCCCGGG - Intergenic
905775669 1:40665725-40665747 CATCCACGCGGCCCCGCCCCCGG - Intergenic
906209306 1:44003227-44003249 GCTCCTGGAGGCCACACCCCAGG + Intronic
912246140 1:107964111-107964133 GAACCCGGAGGCCGCCCCCAGGG - Intronic
913186361 1:116373540-116373562 GCTCCCCGAGCCCCCTCCCCGGG - Intronic
918423520 1:184386890-184386912 GCCTCCGCAGGCCCCGCCCCGGG + Intergenic
920021227 1:202958111-202958133 GACCCCGGGGGCCCCGACCCAGG - Intronic
920504730 1:206507806-206507828 GAACCTGGAGCCCCCGCCCCGGG + Exonic
921390176 1:214607838-214607860 GACCCTGCAGGCCCTGCCCCAGG + Intronic
922124912 1:222712523-222712545 CGCCCCCGAGGCCCCGCCCCGGG + Exonic
922200239 1:223394597-223394619 GCTCCCGCAGGCGCCGCACCTGG - Exonic
1063393708 10:5666700-5666722 GTTCCCGGAGGCGCTGTCCCTGG + Intergenic
1070327387 10:75397408-75397430 CGTCCCCGAGGCCCCGGCCCAGG + Intergenic
1071956930 10:90770363-90770385 GGACCTGGAGGCCCCACCCCAGG + Intronic
1072141521 10:92592998-92593020 GTTCCCGTAGGCCACGCTCCGGG + Intergenic
1072187983 10:93060556-93060578 GAACCCGCAGGCCCCGCCCGAGG + Intergenic
1072784004 10:98268270-98268292 GGCCCCGCAGGCCCCGCCCCGGG + Intergenic
1076807857 10:132868067-132868089 GACCCAGCAGGCCCAGCCCCAGG + Intronic
1077103182 11:831072-831094 GCGCCCGTCGGCCCCGCCCCCGG - Intronic
1077319009 11:1932609-1932631 GACCCAGGAGGCCCCGGCTCTGG - Intronic
1078250520 11:9613383-9613405 GTCCCCTGAGGCCCTGCCCCAGG - Intergenic
1078382696 11:10858519-10858541 GTTCCCGGAGGCCGCACCCCAGG + Intronic
1079128408 11:17734530-17734552 TCTCTCGGAGCCCCCGCCCCTGG + Intergenic
1079128429 11:17734575-17734597 GCTCCCGGGGGACCCGCCCACGG - Intergenic
1080283825 11:30586184-30586206 GACCCCGGAGGTCCCGCCGCAGG + Intronic
1081773980 11:45665448-45665470 GGTCCCTGAGCCCCGGCCCCGGG - Exonic
1082833769 11:57638187-57638209 GCTCCCGGAGCCCCCTCCCCTGG - Intergenic
1083171257 11:60925027-60925049 GAACCCGGCGGCCCCGGTCCCGG + Intronic
1084180569 11:67443596-67443618 GTCCCCGGCGGCCCCGCTCCCGG - Intronic
1084275983 11:68051206-68051228 GACCCCTGAGGCCCGGCACCAGG - Intergenic
1084527547 11:69706114-69706136 GACCCCGGAGCCCCTGTCCCGGG - Intergenic
1084568304 11:69943991-69944013 GAACCCAGAGGGCCCTCCCCTGG - Intergenic
1084568502 11:69945076-69945098 GAACCCAGAGGGCCCTCCCCTGG + Intergenic
1086380279 11:86245177-86245199 TGTGGCGGAGGCCCCGCCCCAGG + Exonic
1089261532 11:117227167-117227189 GCTCCCGTAGGCCACGCCCACGG + Exonic
1089966076 11:122655952-122655974 GGTCCCCGAGCCCCCTCCCCTGG + Exonic
1090736896 11:129618182-129618204 GCCCCCGGAGCCCCAGCCCCGGG - Intergenic
1091847571 12:3669200-3669222 GATGCCAGAGGTCCCACCCCAGG - Intronic
1091923020 12:4320992-4321014 GGTGCGGGAGGCCCCGCCCGCGG - Intergenic
1092160017 12:6310874-6310896 GGTCCCGGCCGCCCCGCCCCCGG - Intronic
1096634421 12:52949352-52949374 TATCCCGGTGGCCAGGCCCCCGG - Exonic
1097357853 12:58621435-58621457 GATGCCGCAAGCCCCGCCCATGG - Intronic
1098161040 12:67648649-67648671 GCCGCCGCAGGCCCCGCCCCCGG - Intronic
1101592875 12:106139116-106139138 GCTCACGGCGGCCCCGGCCCCGG - Exonic
1101738428 12:107481365-107481387 GACCCCGGAGGCCCTGCCCAGGG + Intronic
1101910532 12:108857566-108857588 GCTCCAGGAGGCCCCGGGCCCGG - Exonic
1102043372 12:109814865-109814887 CTTCCTGGAGCCCCCGCCCCTGG - Exonic
1102162566 12:110781627-110781649 GGTCCCAGAAGCCCAGCCCCTGG + Intergenic
1102967751 12:117141237-117141259 GATCCCGGAGGCGCCACGCTGGG + Intergenic
1107146924 13:37069894-37069916 GGACCTGGAGCCCCCGCCCCAGG + Intergenic
1107966865 13:45605039-45605061 GCTCCCTGAGACCCGGCCCCTGG + Intronic
1113628886 13:111866831-111866853 CATCATGGAGGCCCCTCCCCTGG + Intergenic
1113833287 13:113313581-113313603 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833350 13:113313821-113313843 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833389 13:113313965-113313987 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833415 13:113314061-113314083 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833429 13:113314109-113314131 CCTCCGGGAGGCCACGCCCCAGG - Intronic
1113833454 13:113314205-113314227 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833467 13:113314253-113314275 CCTCCGGGAGGCCACGCCCCAGG - Intronic
1113833480 13:113314301-113314323 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833496 13:113314349-113314371 CCTCCAGGAGGCCCCGCCCCAGG - Intronic
1113833522 13:113314445-113314467 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833547 13:113314541-113314563 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833572 13:113314637-113314659 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833597 13:113314733-113314755 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833622 13:113314829-113314851 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833671 13:113315020-113315042 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833695 13:113315116-113315138 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833708 13:113315164-113315186 CCTCCGGGAGGCCACGCCCCAGG - Intronic
1113833722 13:113315212-113315234 CCTCCAGGAGGCCACGCCCCAGG - Intronic
1113833737 13:113315260-113315282 CCTCCAGGAGGCCCCGCCCCAGG - Intronic
1114643799 14:24242349-24242371 GAACCCGGAGGGACCGCCTCCGG - Exonic
1115885169 14:37963084-37963106 GATCCCGGAAGCCCTGCTCTTGG - Intronic
1122153440 14:99736917-99736939 GATCCCAGAGGCATCACCCCAGG - Intergenic
1122429039 14:101628475-101628497 GAGCCCAGCGGCCCCTCCCCGGG - Intergenic
1122643765 14:103177735-103177757 GATACAGGAGGCTCCACCCCAGG + Intergenic
1122651922 14:103230981-103231003 GATCTCGGTTGCCCCTCCCCTGG - Intergenic
1122697382 14:103562687-103562709 GGGCCCGGCAGCCCCGCCCCTGG + Intronic
1123709949 15:22980126-22980148 GATCCCGGAGGCCGCGCCGCCGG + Intronic
1124291610 15:28457131-28457153 GACCCAGCAGGCCCTGCCCCGGG + Intergenic
1129022403 15:72533406-72533428 GAGCCCGTGGGCCCGGCCCCTGG + Intronic
1129156577 15:73721951-73721973 GACCCAGGAGGCTCTGCCCCCGG + Intergenic
1132674167 16:1114806-1114828 GATCCTGGAGGCTGCGCCACTGG - Intergenic
1132785831 16:1656601-1656623 CATCCCCGAGGCCCGGCCCCGGG + Exonic
1132984345 16:2756436-2756458 CACCCCGGCGGCCCCGCACCAGG - Exonic
1133218587 16:4308027-4308049 GATCCCTAAGGACCTGCCCCGGG - Intergenic
1136707171 16:32200539-32200561 GACCCTGCAGGCCCTGCCCCGGG - Intergenic
1136760739 16:32728878-32728900 GACCCTGCAGGCCCTGCCCCGGG + Intergenic
1136807364 16:33141508-33141530 GACCCTGCAGGCCCTGCCCCGGG - Intergenic
1138196073 16:55053192-55053214 GAGCACTGGGGCCCCGCCCCAGG + Intergenic
1138554500 16:57763766-57763788 GATCCCCCAGGCCCGGCCCAAGG + Intronic
1139357030 16:66372658-66372680 GATCCCAGTGGCCCCACCCACGG + Intronic
1139395035 16:66632261-66632283 GAACACGGAGGCCCCGTCCCAGG + Intronic
1140519019 16:75566313-75566335 GGCGCCGGAAGCCCCGCCCCCGG + Intergenic
1141203107 16:81912653-81912675 GATCAGGAAGGCCCCGTCCCGGG - Exonic
1141839745 16:86567093-86567115 CATCCTGGAGGGCGCGCCCCGGG - Intergenic
1142232951 16:88908379-88908401 GACCCTGGAGGCCGCTCCCCGGG + Intronic
1203062891 16_KI270728v1_random:989192-989214 GACCCTGCAGGCCCTGCCCCGGG + Intergenic
1143513572 17:7408313-7408335 GGTCCCGGCGGCGGCGCCCCGGG + Exonic
1143625984 17:8110360-8110382 GAGCCCGGCGCCGCCGCCCCGGG - Intronic
1143885526 17:10062069-10062091 GTTCCCGGTGCCCCCGACCCAGG + Intronic
1144211387 17:13018232-13018254 GCTTCCGGAAGTCCCGCCCCAGG - Intergenic
1144756633 17:17683472-17683494 GATCCCGAGGGCCACGTCCCAGG - Intronic
1144783613 17:17820038-17820060 GCTCCTGGAAGCCCCACCCCGGG + Intronic
1145815731 17:27793762-27793784 GAGCCTGCAGCCCCCGCCCCGGG + Intronic
1147722729 17:42548647-42548669 CATCCCACCGGCCCCGCCCCCGG - Intergenic
1147900272 17:43779024-43779046 GAGCCCGGCGGGCCCGCCCCAGG - Intergenic
1148159341 17:45441250-45441272 CACCCCGGAGGCCCAGACCCAGG - Intronic
1148772841 17:50076897-50076919 GATCAACTAGGCCCCGCCCCTGG - Intronic
1148807878 17:50273336-50273358 GCTCCCGGAAGCTCCGCGCCTGG + Intronic
1148818221 17:50345987-50346009 GGCCCCGCAGGCCCCGCCCCCGG + Intergenic
1150128458 17:62653382-62653404 GATCCTCCAGACCCCGCCCCGGG - Intronic
1151370643 17:73644544-73644566 GGTCCCGGGGGCCCGGCGCCTGG - Intergenic
1151469992 17:74312032-74312054 GATCCTGGAGGCCAGGCACCGGG + Exonic
1152066541 17:78115506-78115528 CCTCCCCGAGGCCCCTCCCCTGG - Intronic
1152627372 17:81393820-81393842 AATCCCGGAGTCCCCGCCCGCGG + Intergenic
1152782369 17:82231958-82231980 ACTCCCGGCAGCCCCGCCCCAGG - Intronic
1154326880 18:13397703-13397725 GACCCAGCAGGCCCTGCCCCAGG + Intronic
1155421856 18:25664896-25664918 GATCCCAGAGCCCCCTCTCCTGG + Intergenic
1160005342 18:75064651-75064673 GCTCCCCGAGGCCCAGCCCACGG - Exonic
1160739816 19:680585-680607 GGTCCGGGTGGTCCCGCCCCAGG - Intronic
1160791493 19:925690-925712 GCCGCGGGAGGCCCCGCCCCCGG - Intergenic
1160847130 19:1171555-1171577 GCTCCCAGAGGCCCCCTCCCAGG - Intronic
1160993883 19:1873029-1873051 GCTCCCAGAGGCCCCACCTCAGG + Intergenic
1161568015 19:5014017-5014039 CTTCCCACAGGCCCCGCCCCGGG - Intronic
1161850664 19:6736612-6736634 CCTCCCGGAGGCCCAGCCGCAGG + Exonic
1161853871 19:6752999-6753021 GATCCTGGAGGTCCCGCCTTAGG + Intronic
1162923772 19:13919257-13919279 GCCCCCAGAGGCCCCGCCGCTGG + Intronic
1163023433 19:14495882-14495904 GATGCCGGAGGCCCCTTCCCAGG - Intronic
1163534480 19:17869293-17869315 GATCCAGGTGGACCCACCCCAGG - Intergenic
1164849785 19:31471983-31472005 GTTCCCGGTGGCCCATCCCCAGG - Intergenic
1164976987 19:32581035-32581057 GATCCCGGAGGCCCCGCCCCAGG + Intergenic
1165077189 19:33286383-33286405 GATCCTGGAGGCCAGTCCCCAGG - Intergenic
1165871392 19:38975752-38975774 GATCTCAGAGTCGCCGCCCCCGG - Exonic
1165879472 19:39032189-39032211 GACCCGGGCGGCCCGGCCCCTGG + Exonic
1166529352 19:43533481-43533503 GGAGCCGGAAGCCCCGCCCCCGG + Exonic
1166688341 19:44809046-44809068 GGAGCCAGAGGCCCCGCCCCCGG - Intronic
1166731927 19:45064187-45064209 CAGCCTGGCGGCCCCGCCCCGGG + Exonic
1166733745 19:45072437-45072459 GGCCCCGGAGGCCCCGCTCCTGG - Exonic
1166792474 19:45406123-45406145 GAGTCCAGAAGCCCCGCCCCTGG + Intronic
1166896002 19:46022304-46022326 AAGCCGGGAGGACCCGCCCCAGG + Intronic
1166962622 19:46507935-46507957 GAGCCGCGGGGCCCCGCCCCAGG - Intronic
1167112870 19:47472069-47472091 GCTCCCCCAGGCCCCTCCCCGGG - Exonic
1167347419 19:48955192-48955214 GATCTCGGAAGCCAAGCCCCCGG + Intronic
1167438999 19:49497440-49497462 CTTCCCTGAGGCCACGCCCCTGG + Intronic
1167613227 19:50517363-50517385 GATCCCAGAGACTCCGCTCCTGG + Exonic
1168094752 19:54108117-54108139 GAACCCGGCAGCCCAGCCCCCGG - Exonic
1168107801 19:54174748-54174770 GATCCAGGAGACCAGGCCCCAGG + Intronic
1168258272 19:55179017-55179039 GTTCCCGGAGCCCCCAACCCCGG - Exonic
925120098 2:1411688-1411710 GACCCCAGAGGCCCTGCTCCTGG + Intronic
925352951 2:3215050-3215072 GATCCTGGACTTCCCGCCCCAGG + Intronic
926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG + Intergenic
926155021 2:10448674-10448696 GACGCCGCAGGCCCCGGCCCCGG + Intergenic
927558063 2:24049824-24049846 GGTCCCACAGGCCCCGCCTCTGG - Exonic
929218189 2:39437371-39437393 GATCCCGGAGGGAGCGCGCCAGG + Intergenic
929452783 2:42048057-42048079 GGCCCCGGCGGCCCCGACCCCGG - Exonic
931671744 2:64653953-64653975 GGCGCCGCAGGCCCCGCCCCTGG + Intronic
932887516 2:75560828-75560850 GACCCCGGCGGCCCCTCCGCCGG - Intronic
934732637 2:96669211-96669233 GTGCCCCGAGGCCCCGGCCCTGG + Intergenic
944480102 2:200148429-200148451 GATCCCGGAGTTCCAGCCCTGGG - Intergenic
948478988 2:238238996-238239018 GATCCCGGAGCGCCCCCCGCAGG + Exonic
949040995 2:241849982-241850004 GATGCTGGTGGCCCTGCCCCAGG + Exonic
1168965462 20:1895451-1895473 GAGCCCGCCGGCCCGGCCCCCGG + Exonic
1171187447 20:23132991-23133013 GATCCTGGAGCCCCCACCTCTGG - Intergenic
1171767252 20:29297057-29297079 GATCCCGGAGGCACCCCCAGGGG + Intergenic
1172534751 20:35664675-35664697 GCCTCCGAAGGCCCCGCCCCGGG + Intronic
1172813491 20:37668539-37668561 GATCTCGGAGACCCAGCCCCCGG - Intergenic
1173079189 20:39849879-39849901 GCTCCCGGAGCCTCCGGCCCTGG + Intergenic
1174313811 20:49681418-49681440 GATCCCCAAGGCCCAGACCCTGG + Intronic
1174436381 20:50510136-50510158 GACCCCGGGAGCCCCGCCCACGG - Intergenic
1175399696 20:58693212-58693234 GCCCGCGGAGGCCCAGCCCCAGG + Intronic
1175439651 20:58981555-58981577 GACCCCGGCGGCCGCGCCGCGGG - Intronic
1175562179 20:59939866-59939888 GATCCCGGAAGCTCGGCCCCCGG - Exonic
1175972340 20:62693078-62693100 AATCCCGCAGGCCCCGCCCCAGG + Intergenic
1176100318 20:63361590-63361612 GACCCCGGGGTCCCCGTCCCCGG - Intronic
1176145076 20:63561894-63561916 CAGCCCGGAGGCCCCCCCCGTGG - Exonic
1176286438 21:5021570-5021592 CCTCCCGGAGCCCCCGCCTCTGG - Intergenic
1176547446 21:8207971-8207993 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
1176555351 21:8252180-8252202 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
1176566397 21:8391018-8391040 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
1176574273 21:8435205-8435227 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
1178914741 21:36699956-36699978 GAGCCCGGCGGCCCCGGCCCAGG + Intronic
1179870743 21:44241905-44241927 CCTCCCGGAGCCCCCGCCTCTGG + Intergenic
1179912614 21:44458202-44458224 GATGCGGGAGGCCCTGCCCCAGG + Exonic
1180002070 21:44999704-44999726 CATCCTGGAGGCCCCTGCCCCGG - Intergenic
1181147403 22:20858704-20858726 GATGGCGGCGGCCCCGGCCCGGG - Exonic
1181428064 22:22856644-22856666 GGTCCCCGAGGCCCCTTCCCTGG - Intronic
1183194559 22:36344473-36344495 CATCCAGGCGGCCCCGCCCAGGG + Intronic
1183453010 22:37906720-37906742 GGTCCCTGAGACCCCGGCCCAGG + Intronic
1183736192 22:39646147-39646169 GATCGCTGAGGCCTCGCTCCAGG - Intronic
1183782827 22:40009584-40009606 AATCCAGCAGGCCCCACCCCGGG - Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184568860 22:45309845-45309867 GTCCCCGGAGGCCCCGCCCCGGG - Intronic
1184674783 22:46035865-46035887 CCACCCAGAGGCCCCGCCCCTGG + Intergenic
1185269302 22:49921597-49921619 GATCCCAGAGGCCCTGCAGCGGG + Exonic
1203252319 22_KI270733v1_random:124256-124278 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
1203260376 22_KI270733v1_random:169342-169364 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
950264482 3:11564004-11564026 GAGCCCGGAGGCACCCCCTCGGG + Intronic
950403393 3:12788472-12788494 CATCCCCGAGGCCAGGCCCCTGG + Intergenic
952730354 3:36631752-36631774 GCTCTCGGAGGTCCTGCCCCTGG + Intergenic
952816776 3:37453060-37453082 GATCCCAGACACCCTGCCCCTGG - Intronic
955770465 3:62379757-62379779 GATCCCTGATGCTCCACCCCGGG + Intergenic
956179112 3:66501052-66501074 GGTCCCCCAAGCCCCGCCCCCGG + Intronic
956877766 3:73480289-73480311 GATCACAAAGGGCCCGCCCCAGG - Intronic
958000347 3:87741481-87741503 GATCCCAGAAGGCCCACCCCTGG + Intergenic
960120876 3:113947893-113947915 GCTTCCGGGTGCCCCGCCCCCGG - Exonic
960844408 3:121993390-121993412 GGCCCCGCAGGCCCAGCCCCCGG - Exonic
961825480 3:129596954-129596976 GAGCTCAGAGGCCCAGCCCCAGG + Intronic
962876204 3:139537964-139537986 GATGCCGGAAGGCCAGCCCCAGG - Intronic
966595711 3:181723290-181723312 GATCCCCGCGGCCCTGCCGCTGG + Intergenic
966732557 3:183162869-183162891 GGTCCCAGAGGCCCGGGCCCCGG - Exonic
966919861 3:184604363-184604385 GAAACCGGAGCCCCCGCGCCGGG + Intronic
968170207 3:196503838-196503860 GACCCCGGAAGTCCCGCCCCGGG - Intergenic
968230702 3:197003189-197003211 GCTACCTGAGGCGCCGCCCCCGG - Exonic
968612608 4:1563997-1564019 GGTCCCGGCGGCCCCAGCCCTGG + Intergenic
973330450 4:48906508-48906530 GACCCCGGCGGCCCCGGCACGGG - Intronic
973386382 4:49516906-49516928 GGTCCCTGAGGCCCAGCCCAAGG + Intergenic
975984532 4:80190206-80190228 GTTCCCGCAGGCCCCGCCCTTGG + Intronic
984146341 4:176065932-176065954 GGGCCCGGCCGCCCCGCCCCCGG + Intronic
984778919 4:183506049-183506071 AAGCCCGCAGGCCCCGCCCCCGG - Intronic
984928394 4:184826114-184826136 CCGCCCGCAGGCCCCGCCCCCGG + Intronic
985475777 5:78284-78306 GAGGCAGGAGGCCCCTCCCCGGG + Intergenic
985666215 5:1182725-1182747 AGTCCCGGAGTCCCCGACCCTGG - Intergenic
985822040 5:2166988-2167010 GATCCTGGAGGCCCGGCCATAGG - Intergenic
986695954 5:10354154-10354176 TAGCCCCGAGGCCCCGACCCCGG - Intronic
989170432 5:38467207-38467229 GTTCCTGGAGGCCCCACCTCAGG + Intergenic
990910076 5:60843988-60844010 GCTCCCGGGGCCCCCGCACCCGG + Intronic
992085818 5:73277530-73277552 GATCCCGGAGGCAGAGCCCTTGG - Intergenic
992269709 5:75052745-75052767 GCTGCCCGAGCCCCCGCCCCTGG - Intergenic
994175121 5:96702727-96702749 CTGCCCGGCGGCCCCGCCCCGGG - Intronic
994245547 5:97471746-97471768 GGACCTGGAGCCCCCGCCCCAGG - Intergenic
997253664 5:132410797-132410819 GAGCCCGGGGCCCCCGCCTCTGG + Intronic
997980512 5:138465214-138465236 GGTCCCGGAGGCCCCGGCGGCGG + Intergenic
998379956 5:141717305-141717327 GATCACATAGGCTCCGCCCCTGG - Intergenic
999384215 5:151142868-151142890 GACCCTGGAGGACCTGCCCCTGG - Intronic
1000042202 5:157493125-157493147 GAGCTCTGAGGCCCGGCCCCTGG - Exonic
1001704309 5:173730746-173730768 GATGCCTGGGGCACCGCCCCTGG - Intergenic
1002163979 5:177333241-177333263 GATCAGGCAGGCCCTGCCCCTGG - Intronic
1002501402 5:179649788-179649810 GCTCCCGGAGGCGTCGTCCCTGG - Intergenic
1002519213 5:179781866-179781888 GATCCTGGATTCCCCTCCCCTGG + Intronic
1002798253 6:494578-494600 GATCCCTAAGGCCCCACCCTAGG + Intronic
1003921713 6:10838647-10838669 GCTCCATGAAGCCCCGCCCCGGG - Intronic
1005334060 6:24775444-24775466 TGTCCCGGAGGCCCAGCGCCAGG - Intronic
1005968713 6:30744461-30744483 CATCCTGCAGGCCCCGACCCCGG - Exonic
1007390264 6:41546556-41546578 GACCCCGGCGTCCCCGCCCCCGG - Exonic
1007775732 6:44223490-44223512 GACGCCCGCGGCCCCGCCCCCGG - Intronic
1007848441 6:44780365-44780387 CATCCCGGAGTGCCCGGCCCAGG - Intergenic
1010209874 6:73354310-73354332 GCACCTGGTGGCCCCGCCCCCGG + Intergenic
1016330173 6:142946210-142946232 GAGCCCGGCGGCCCCTGCCCCGG - Intergenic
1017021675 6:150144227-150144249 GATCCCGCAGGCCCCCCGCAGGG - Intronic
1017103209 6:150866102-150866124 GGTCCCGGGCGCTCCGCCCCTGG - Intronic
1017311692 6:152983264-152983286 GTGCTCGGAGGTCCCGCCCCCGG - Intronic
1017819603 6:158039740-158039762 CATCTCGGTGGCCTCGCCCCAGG + Intronic
1018876639 6:167827248-167827270 GGTCGCGCAGGCCCCGCGCCCGG - Intronic
1019551020 7:1602598-1602620 GACCCCCGCGGCCCCGCACCTGG + Intergenic
1019612442 7:1943709-1943731 GATCCAGCAGGCCCAGTCCCAGG + Intronic
1020008130 7:4792964-4792986 GGTCAGGGAAGCCCCGCCCCAGG - Intronic
1020727300 7:11831911-11831933 GCTCCCGGACGCCCAGCGCCTGG + Exonic
1026982750 7:74536271-74536293 GCTCGGTGAGGCCCCGCCCCTGG + Exonic
1029110953 7:98212804-98212826 GGCCACGGAGGCCCAGCCCCAGG + Exonic
1032081234 7:128859456-128859478 CATCCCCGAGCCCCCACCCCCGG - Intergenic
1034944493 7:155253263-155253285 CATCCCGAAGGCTCTGCCCCAGG - Intergenic
1038566336 8:28622696-28622718 GCCCCCTGAGGCCCCGCCCTCGG - Intronic
1049536449 8:143184600-143184622 GATCCTGGAAGCCCCATCCCAGG - Intergenic
1053129225 9:35605674-35605696 GGCCCCGGGGGCCCCTCCCCCGG - Exonic
1053163505 9:35829349-35829371 GACACCGGAGGCCACCCCCCGGG + Intronic
1056472371 9:86918360-86918382 GATTGCTGAGGCCCAGCCCCAGG - Intergenic
1059337817 9:113580199-113580221 GCTGCCTGAGGCCCCGCACCTGG - Intronic
1060789791 9:126478395-126478417 GAGCCCCCAGGCCCTGCCCCTGG + Intronic
1061669177 9:132179083-132179105 GACCCTGGAGGCTCCACCCCAGG + Intronic
1061836603 9:133333717-133333739 GATCCAGGAGGCCCGGGGCCAGG - Exonic
1061862049 9:133473165-133473187 GAGCCCTGAGGCCACGCCACGGG + Exonic
1061882444 9:133575037-133575059 GGTGCCGGAGGCTCTGCCCCAGG - Exonic
1062076037 9:134590470-134590492 GAAGCCGGAGGCCCAGTCCCAGG - Intergenic
1062338358 9:136082358-136082380 CATCCCGGAGGCCCATCCGCCGG - Intronic
1062357977 9:136173981-136174003 GCTCCCTGAGACCCTGCCCCAGG - Intergenic
1062444307 9:136587280-136587302 GCTCCTGCCGGCCCCGCCCCCGG - Intergenic
1203468724 Un_GL000220v1:107407-107429 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
1203476545 Un_GL000220v1:151379-151401 GAGCCCCGGGGCCCCGCCACCGG - Intergenic
1185623314 X:1466474-1466496 GATCGCGGTGGCCCTGCCCGTGG - Exonic
1186747353 X:12583611-12583633 GCACCTGGCGGCCCCGCCCCCGG + Intronic
1189473160 X:41329959-41329981 GACCCAGGAGGCCCTTCCCCTGG + Intergenic
1190322279 X:49186262-49186284 GGTCCCGGAGGCGCCGCTCCGGG - Exonic
1192153008 X:68723709-68723731 CATCCCAGAGGGCCCGCTCCCGG - Exonic
1195701647 X:107710202-107710224 GGTCCCAGAGGCCCTGCCCCTGG + Intergenic
1198205327 X:134460105-134460127 CGCCCCGCAGGCCCCGCCCCCGG - Intergenic
1198369231 X:135974318-135974340 CCTCCCGTAGGCCCCGCCCTCGG - Intergenic
1200244597 X:154516253-154516275 CAGCCCGCCGGCCCCGCCCCCGG + Intergenic