ID: 1164977009

View in Genome Browser
Species Human (GRCh38)
Location 19:32581086-32581108
Sequence CCCGATTCCCCGATTTCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164977009_1164977026 29 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977026 19:32581138-32581160 GGCGTGGCTCCGGGCTGGATTGG 0: 1
1: 0
2: 0
3: 13
4: 121
1164977009_1164977025 24 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977025 19:32581133-32581155 CGCGGGGCGTGGCTCCGGGCTGG 0: 1
1: 0
2: 1
3: 43
4: 284
1164977009_1164977019 8 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977019 19:32581117-32581139 GGCGCCCTGGCAGCGGCGCGGGG 0: 1
1: 0
2: 0
3: 22
4: 238
1164977009_1164977015 1 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977015 19:32581110-32581132 CTCTGCCGGCGCCCTGGCAGCGG 0: 1
1: 0
2: 1
3: 22
4: 239
1164977009_1164977013 -5 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977013 19:32581104-32581126 TCGGGCCTCTGCCGGCGCCCTGG 0: 1
1: 0
2: 3
3: 9
4: 180
1164977009_1164977022 13 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977022 19:32581122-32581144 CCTGGCAGCGGCGCGGGGCGTGG 0: 1
1: 3
2: 5
3: 59
4: 588
1164977009_1164977017 6 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977017 19:32581115-32581137 CCGGCGCCCTGGCAGCGGCGCGG 0: 1
1: 0
2: 1
3: 18
4: 206
1164977009_1164977018 7 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977018 19:32581116-32581138 CGGCGCCCTGGCAGCGGCGCGGG 0: 1
1: 0
2: 1
3: 18
4: 224
1164977009_1164977023 19 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977023 19:32581128-32581150 AGCGGCGCGGGGCGTGGCTCCGG 0: 1
1: 0
2: 3
3: 30
4: 231
1164977009_1164977024 20 Left 1164977009 19:32581086-32581108 CCGCCTGAAATCGGGGAATCGGG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1164977024 19:32581129-32581151 GCGGCGCGGGGCGTGGCTCCGGG 0: 1
1: 0
2: 9
3: 50
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164977009 Original CRISPR CCCGATTCCCCGATTTCAGG CGG (reversed) Exonic
1067087421 10:43250270-43250292 CCCCATTCCCCCATTCCAGGTGG - Intronic
1067286470 10:44911189-44911211 CCCTAATCGCCGATCTCAGGCGG + Exonic
1071156249 10:82692656-82692678 CCCCATTCCCCAAGTACAGGTGG + Intronic
1076885134 10:133258741-133258763 GCCGCTTCCCCGCTGTCAGGGGG - Intergenic
1096475532 12:51907056-51907078 CCCGGCGCCCCGATTCCAGGCGG + Intronic
1099893231 12:88614389-88614411 CCCTAATCCCACATTTCAGGTGG - Intergenic
1104376057 12:128266720-128266742 CCCCATTCCTCAACTTCAGGTGG - Intergenic
1110648415 13:77916496-77916518 ATCGATTCCCCCATTTCCGGGGG + Intronic
1112405665 13:99117946-99117968 CTCGAATCCCTGACTTCAGGTGG + Intergenic
1113910017 13:113837260-113837282 CCCCATCCCCCGATTTCAAAAGG - Intronic
1121505594 14:94474351-94474373 GCCAACTCCCCGACTTCAGGTGG - Intronic
1123003862 14:105312062-105312084 CCCCACTCCCCGACTTCAGCAGG + Exonic
1123068929 14:105631701-105631723 CCAGATTCCCCCTTTTCATGAGG + Intergenic
1123073086 14:105651659-105651681 CCAGATTCCCCCTTTTCATGAGG + Intergenic
1123093008 14:105750429-105750451 CCAGATTCCCCCTTTTCATGAGG + Intergenic
1123098478 14:105777526-105777548 CCAGATTCCCCCTTTTCATGAGG + Intergenic
1123107459 14:105849330-105849352 CCAGATTCCCCCTTTTCATGAGG - Intergenic
1129737555 15:77974638-77974660 CCCGAAGCCCAGATTTCAGAGGG - Intergenic
1132342474 15:101087136-101087158 CCCGATGCCGCTATTTCAGAGGG - Intergenic
1138592876 16:58012071-58012093 CCCCATTCCCACAGTTCAGGGGG + Intronic
1141602796 16:85136672-85136694 CCAGCTGCCCCGATTTCACGGGG + Intergenic
1148463908 17:47853159-47853181 CTCAATCCCCCGATGTCAGGCGG - Intronic
1152039741 17:77894960-77894982 CCCCATTCCCGGAGTTTAGGGGG - Intergenic
1162034066 19:7929764-7929786 GCCGACTGCCCTATTTCAGGTGG - Intronic
1164977009 19:32581086-32581108 CCCGATTCCCCGATTTCAGGCGG - Exonic
1165486942 19:36101934-36101956 CCCGCTTTCTCCATTTCAGGTGG + Intronic
1170064713 20:12298924-12298946 GCCGGTTCCCAGACTTCAGGTGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
960090284 3:113631632-113631654 CCAGATTCCTCGAATTCATGGGG - Intergenic
968228321 3:196989740-196989762 CCAAATTCCCCCCTTTCAGGAGG - Intronic
973974308 4:56246751-56246773 CCCCATTTCCCAATTTCAGAGGG - Intronic
977683318 4:99818713-99818735 CCAGATTTCCCTATTTCAGAAGG + Intronic
1029551933 7:101241157-101241179 CCCGATTTCCTCATTTCAGTTGG - Intronic
1192308487 X:69988634-69988656 CTCGAATCCCTGACTTCAGGTGG - Intronic