ID: 1164977033

View in Genome Browser
Species Human (GRCh38)
Location 19:32581172-32581194
Sequence CCCCGCGAGCGCCTGCGCAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164977020_1164977033 28 Left 1164977020 19:32581121-32581143 CCCTGGCAGCGGCGCGGGGCGTG 0: 1
1: 0
2: 5
3: 12
4: 158
Right 1164977033 19:32581172-32581194 CCCCGCGAGCGCCTGCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 122
1164977021_1164977033 27 Left 1164977021 19:32581122-32581144 CCTGGCAGCGGCGCGGGGCGTGG 0: 1
1: 0
2: 6
3: 35
4: 363
Right 1164977033 19:32581172-32581194 CCCCGCGAGCGCCTGCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 122
1164977028_1164977033 2 Left 1164977028 19:32581147-32581169 CCGGGCTGGATTGGTGGCGCCTG 0: 1
1: 0
2: 1
3: 22
4: 386
Right 1164977033 19:32581172-32581194 CCCCGCGAGCGCCTGCGCAGTGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164977033 Original CRISPR CCCCGCGAGCGCCTGCGCAG TGG Exonic
900240507 1:1615329-1615351 GCCTCCGGGCGCCTGCGCAGTGG - Intergenic
900409177 1:2505096-2505118 CCCCGAGGGCGCCTGCTCCGTGG + Exonic
900483687 1:2911348-2911370 CCACGCGCGCGCCTGGGTAGGGG - Intergenic
903055473 1:20633440-20633462 CAGCGCCTGCGCCTGCGCAGAGG + Exonic
903349921 1:22711209-22711231 CCCCGCGGGCGCCCGGGGAGCGG + Intronic
903650559 1:24919202-24919224 CCCCCTGAGCCCCTGCGCGGGGG - Intronic
904822675 1:33256014-33256036 CCCCGGGAGCCCCCGCGCTGGGG + Intergenic
906210810 1:44011348-44011370 CCCCGCAGTCGCCTGCCCAGGGG - Intronic
911618346 1:100038591-100038613 CCCCACGTGCGCCTCCGCCGCGG + Intronic
914313389 1:146487014-146487036 CCCCGAAAGCGACTGGGCAGGGG - Intergenic
914500961 1:148246367-148246389 CCCCGAAAGCGACTGGGCAGGGG + Intergenic
917883976 1:179365702-179365724 CCCCACCGGCGCCTGCGCACTGG + Exonic
921110889 1:212035602-212035624 CTCCTTGAGCGCCTGCGCAGGGG - Exonic
922375726 1:224962634-224962656 CCCTGCGAGAACCTGAGCAGAGG + Intronic
922499075 1:226083594-226083616 CCACGCGGCCGCCTGCACAGGGG + Intergenic
924560831 1:245155588-245155610 CCCCGGGGGCGCCTCTGCAGCGG - Intronic
1064030615 10:11880499-11880521 TCCCGCTGGGGCCTGCGCAGAGG + Intergenic
1065614230 10:27504125-27504147 CCCCACCTGCGCTTGCGCAGGGG + Intergenic
1072021821 10:91410239-91410261 CCCCGCGCGCGCCAGCCCCGCGG - Intergenic
1076945049 10:133640804-133640826 CGCCGCCAGCGCCTTCGCTGTGG + Intergenic
1077176710 11:1194409-1194431 CCCGGCAAGAGCCTGAGCAGCGG + Intronic
1077359187 11:2133144-2133166 TCCACCCAGCGCCTGCGCAGGGG - Exonic
1079128607 11:17735223-17735245 CCCCGGGTGCCCCTGCCCAGGGG + Exonic
1081488272 11:43547939-43547961 CCCCGAGAGCTCCCGCGCGGGGG - Intergenic
1081528277 11:43942076-43942098 GCGCGCGCGCGCCTGCGGAGGGG + Intronic
1082959573 11:58905791-58905813 GCCCGCGAGCGCGTGCGCCCAGG + Intronic
1083674516 11:64318081-64318103 GGCCGCTCGCGCCTGCGCAGTGG + Exonic
1083816438 11:65134826-65134848 CCCCGCGAGCAGCTGGGAAGGGG + Intergenic
1083845951 11:65333776-65333798 CCCGGACGGCGCCTGCGCAGAGG + Exonic
1083995227 11:66268477-66268499 CCCCGACTACGCCTGCGCAGCGG + Intergenic
1085666329 11:78418004-78418026 CCCCGCGTCCGCGTGCGCGGCGG - Intronic
1089340305 11:117752847-117752869 CCCTGGGAGAGCCTGCTCAGTGG - Intronic
1092521791 12:9283637-9283659 CCCGGAGTGCGCATGCGCAGCGG + Intergenic
1092545493 12:9448219-9448241 CCCGGAGTGCGCATGCGCAGCGG - Intergenic
1094507460 12:31073832-31073854 CCCGGAGTGCGCATGCGCAGCGG + Intronic
1095986254 12:48001617-48001639 CCCGGGAAGCGCCGGCGCAGGGG + Intronic
1096478570 12:51923500-51923522 CCCCGCGGGGGTCTGAGCAGGGG - Intergenic
1098769669 12:74537762-74537784 CCCTCAGAGCGCCTGCGCACTGG - Intergenic
1101144844 12:101831023-101831045 CCCCACCTGCGCTTGCGCAGCGG + Intergenic
1114083139 14:19218823-19218845 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1122876052 14:104665921-104665943 CCACGCCAGGGCCTGCGGAGTGG - Intergenic
1129334247 15:74843038-74843060 CTCACCGAGCGCCTGGGCAGCGG - Exonic
1129612333 15:77070820-77070842 CCCCACGGGCGCCTCCGCCGCGG + Intronic
1130988474 15:88860327-88860349 CCCCGCCAGGTCCTGTGCAGAGG + Exonic
1132574367 16:657784-657806 CCCCGCGAGCCCCAGCGCCCTGG + Exonic
1132807592 16:1782269-1782291 CCAGGCGAGCGCGTGTGCAGCGG + Intronic
1135296512 16:21283858-21283880 GCCCGCGGGCGGCTGCGCGGCGG + Intronic
1135821722 16:25691886-25691908 CCTCGCGCGCGCCTGCGAAGGGG - Intergenic
1140500970 16:75433198-75433220 CCCCGCGGGCGTCTGCCCTGTGG - Intronic
1141456425 16:84145255-84145277 TCCCGAGTGCGCGTGCGCAGCGG + Intergenic
1141608858 16:85170204-85170226 CTCCGCGCGCCCCTGCGCCGAGG - Intergenic
1141765998 16:86060472-86060494 CCGACCGAGCCCCTGCGCAGGGG - Intergenic
1143139191 17:4731401-4731423 CTCGGTGTGCGCCTGCGCAGAGG - Intergenic
1143174618 17:4948985-4949007 CCGCGCCTGCGCCTGCGCCGGGG + Exonic
1143485521 17:7251709-7251731 CCCCTAGCGCGCCTGCGCAGCGG - Intronic
1143873785 17:9976529-9976551 CCCAGAGAGCCCCTGCTCAGAGG + Intronic
1144764403 17:17724901-17724923 CCGCACGAGAGCCTGCCCAGTGG + Intronic
1146271470 17:31488284-31488306 CCCTGCGAGCGCCAGCCCCGGGG - Intronic
1147341292 17:39754528-39754550 CGCCGGGAGATCCTGCGCAGCGG + Intergenic
1148936348 17:51166778-51166800 CCCCGCCAGAGCCTGCGCCCGGG + Exonic
1152611615 17:81317626-81317648 CCCCACGAGGGCCCGTGCAGGGG - Intronic
1154499839 18:14990498-14990520 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
1157848969 18:51030201-51030223 CCCCGCGCGCGCATGCTCAGTGG + Exonic
1159051194 18:63422559-63422581 CCCAGGGAGGGCCTGCGCTGTGG - Intergenic
1160452464 18:78974562-78974584 TCCCGGGAGCGCCGGCGGAGAGG - Intergenic
1161219204 19:3110338-3110360 GCCCGCGGGCGCCTGGGGAGGGG + Intronic
1162485991 19:10960955-10960977 GCCGGCGAGCGCGCGCGCAGCGG + Intergenic
1163662980 19:18589483-18589505 CACCGCCAGTACCTGCGCAGCGG + Exonic
1164977033 19:32581172-32581194 CCCCGCGAGCGCCTGCGCAGTGG + Exonic
1166957041 19:46471543-46471565 CGCAGCGCGCGCCTGCGCACTGG + Exonic
1166961040 19:46495919-46495941 TCGCGCGTGCGCCTGCGCAGAGG + Exonic
925750302 2:7083882-7083904 ACCCGCAAGGGCCTGCGCTGGGG + Intergenic
926692203 2:15745206-15745228 CTCAGAGAGCGCCTGCCCAGAGG + Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
933139867 2:78779328-78779350 GACCGCGAGCCCCTGAGCAGGGG - Intergenic
936512259 2:113157630-113157652 GCCGGCGAGCACCTGCGGAGCGG + Intronic
938499050 2:131820853-131820875 CCCCACGAGGGGCTGTGCAGTGG + Intergenic
948399737 2:237674958-237674980 CCCAGAGAGAGCCTGGGCAGTGG + Intronic
1174896212 20:54452485-54452507 GTCCGCAAGCGCATGCGCAGGGG - Intergenic
1176096314 20:63346012-63346034 CCCGCGGAGGGCCTGCGCAGGGG + Exonic
1180294834 22:10874444-10874466 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1180497640 22:15903858-15903880 CCCCACGAGGGGCTGTGCAGTGG - Intergenic
1182586298 22:31346016-31346038 GCGCGCGCGCGCCTGCGCGGCGG - Exonic
1185095907 22:48806069-48806091 CCCCGAGAGCCCCTTCCCAGAGG + Intronic
950153838 3:10708029-10708051 CCCCGCGCTCGCCTGCCCCGCGG + Intronic
954151833 3:48661796-48661818 CCCCGGGAGCGCATGCGCTTGGG + Exonic
962809573 3:138949117-138949139 CCCAGCCAGGGCCTGGGCAGGGG + Intronic
966866127 3:184260047-184260069 GCCCGCGGGCGCCTGGGCCGGGG + Exonic
968148354 3:196318297-196318319 CCCTGCCCGCGCCTGCGCACCGG + Intronic
968199384 3:196739746-196739768 CCCCGCGCGGGCCTGCCCATGGG + Intergenic
968464349 4:742989-743011 CCCCCCACGCTCCTGCGCAGTGG - Intronic
968506523 4:973579-973601 CGCGGCCCGCGCCTGCGCAGTGG - Intronic
968642366 4:1721099-1721121 CCCCGCGAGCGGCCGAGCGGCGG - Exonic
969436537 4:7192422-7192444 TCCCACGAGCGCCTGGGCGGCGG + Intergenic
972675594 4:41257161-41257183 CCCCGCGAGCGCCGAGGCGGGGG + Intronic
976281986 4:83334805-83334827 CCCCGCCAGCTGCCGCGCAGCGG + Exonic
980328449 4:131379465-131379487 GCCAGCCAGCGCCTGCTCAGGGG + Intergenic
982573304 4:157076504-157076526 CTCCGCGGGCGCCACCGCAGCGG - Intronic
985448432 4:190041314-190041336 CGCCGCCAGCGCCTTCGCTGTGG + Intergenic
987063478 5:14264814-14264836 CTCCGCAAGCGCACGCGCAGAGG - Intronic
989584795 5:43066420-43066442 CGCCGCGAGCGCCGACGCACGGG - Intronic
990557461 5:56951300-56951322 CCCAGCGAGCTCCAGCCCAGGGG + Intronic
990581875 5:57173746-57173768 CCCCGCGCGCCCCTGCTCCGGGG + Intergenic
991684190 5:69166926-69166948 GCCCGAGAGCGCAGGCGCAGAGG + Intergenic
992820115 5:80487990-80488012 CCCGGCGGGCGCCAGCGAAGCGG - Exonic
992866219 5:80960169-80960191 CCCGGCGGGCGCCCGAGCAGAGG + Intergenic
993040877 5:82813415-82813437 CACAGCGAGAGCCTGCCCAGGGG - Intergenic
998222998 5:140303081-140303103 CACTGTAAGCGCCTGCGCAGTGG + Exonic
1004174578 6:13328568-13328590 CCGGGCGGGCGCATGCGCAGAGG + Intronic
1005886381 6:30100929-30100951 CCCGGCGCGTGGCTGCGCAGCGG - Intergenic
1006627463 6:35407358-35407380 CCCCGAGAGCCACAGCGCAGTGG - Intronic
1007673498 6:43576051-43576073 TTCCGCGGGCGCGTGCGCAGTGG - Exonic
1017073839 6:150600150-150600172 CCCTGCGCGCCCCTCCGCAGTGG + Intronic
1020002522 7:4764013-4764035 TCCCGCCAGGGCCTGGGCAGAGG - Exonic
1028997540 7:97117685-97117707 CGCCGACTGCGCCTGCGCAGAGG - Exonic
1034488437 7:151380657-151380679 CCCCTCGAGCCCCTGGGCACAGG + Intronic
1034493605 7:151407484-151407506 CCCCGGGAGCCCCTGGGCTGGGG - Intronic
1037768190 8:21784477-21784499 CCCCGGGAGGCCCTGCTCAGGGG + Intronic
1037882185 8:22578829-22578851 CCCCTCGATCGTCTGCGAAGTGG + Exonic
1038734495 8:30156644-30156666 CCCCACATGCGCCTGCGCAGAGG + Intronic
1039521645 8:38176799-38176821 GCCCGCGGGCGCCTGCGCGATGG + Exonic
1039979120 8:42391792-42391814 CCCCGAGAGCGCCTGTGCGCCGG - Intronic
1054738411 9:68780009-68780031 CATCGCGAGCGCCTGCGCGAAGG + Intronic
1056732455 9:89178042-89178064 CCCCGAGGGGGCCTGGGCAGCGG + Exonic
1060952329 9:127612206-127612228 CCCCGCGCGCGCCGGCGGCGGGG + Intergenic
1062517783 9:136944770-136944792 CCCCTCGTGCGCCTGCGCCTTGG + Intronic
1203451399 Un_GL000219v1:120544-120566 CCCCGGCAGGGCCAGCGCAGGGG + Intergenic
1191253047 X:58268392-58268414 CCCCGCCAGGGACAGCGCAGGGG + Intergenic
1192928596 X:75781829-75781851 CGCGGAGTGCGCCTGCGCAGTGG + Intergenic