ID: 1164986092

View in Genome Browser
Species Human (GRCh38)
Location 19:32649831-32649853
Sequence TGTTCTGCTGAGGTGGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164986092_1164986101 15 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986101 19:32649869-32649891 CGCTCCAGCTGGACACACAGCGG 0: 1
1: 0
2: 2
3: 12
4: 134
1164986092_1164986104 25 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248
1164986092_1164986096 -8 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986096 19:32649846-32649868 GCAGAACAAGGTGTCCCCAAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
1164986092_1164986102 16 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986102 19:32649870-32649892 GCTCCAGCTGGACACACAGCGGG 0: 1
1: 0
2: 11
3: 34
4: 275
1164986092_1164986097 4 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164986092 Original CRISPR TGTTCTGCTGAGGTGGTAAA TGG (reversed) Intronic