ID: 1164986095

View in Genome Browser
Species Human (GRCh38)
Location 19:32649841-32649863
Sequence GGGGACACCTTGTTCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164986095_1164986102 6 Left 1164986095 19:32649841-32649863 CCTCAGCAGAACAAGGTGTCCCC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1164986102 19:32649870-32649892 GCTCCAGCTGGACACACAGCGGG 0: 1
1: 0
2: 11
3: 34
4: 275
1164986095_1164986104 15 Left 1164986095 19:32649841-32649863 CCTCAGCAGAACAAGGTGTCCCC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1164986104 19:32649879-32649901 GGACACACAGCGGGACCTGCTGG 0: 1
1: 0
2: 2
3: 22
4: 248
1164986095_1164986097 -6 Left 1164986095 19:32649841-32649863 CCTCAGCAGAACAAGGTGTCCCC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1164986097 19:32649858-32649880 GTCCCCAAAGGCGCTCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 109
1164986095_1164986101 5 Left 1164986095 19:32649841-32649863 CCTCAGCAGAACAAGGTGTCCCC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1164986101 19:32649869-32649891 CGCTCCAGCTGGACACACAGCGG 0: 1
1: 0
2: 2
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164986095 Original CRISPR GGGGACACCTTGTTCTGCTG AGG (reversed) Intronic