ID: 1164986096

View in Genome Browser
Species Human (GRCh38)
Location 19:32649846-32649868
Sequence GCAGAACAAGGTGTCCCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164986092_1164986096 -8 Left 1164986092 19:32649831-32649853 CCATTTACCACCTCAGCAGAACA 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1164986096 19:32649846-32649868 GCAGAACAAGGTGTCCCCAAAGG 0: 1
1: 0
2: 0
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164986096 Original CRISPR GCAGAACAAGGTGTCCCCAA AGG Intronic